CSNK1D

CSNK1D
Available structures
PDBOrtholog search: PDBe RCSB
Identifiers
AliasesCSNK1D, ASPS, CKIdelta, FASPS2, HCKID, casein kinase 1 delta, CKId, CKI-delta
External IDsOMIM: 600864; MGI: 1355272; HomoloGene: 74841; GeneCards: CSNK1D; OMA:CSNK1D - orthologs
EC number2.7.11.26
Orthologs
SpeciesHumanMouse
Entrez

1453

104318

Ensembl

ENSG00000141551

ENSMUSG00000025162

UniProt

P48730

Q9DC28

RefSeq (mRNA)

NM_001893
NM_139062
NM_001363749

NM_027874
NM_139059

RefSeq (protein)

NP_001884
NP_620693
NP_001350678

NP_082150
NP_620690

Location (UCSC)Chr 17: 82.24 – 82.27 MbChr 11: 120.85 – 120.88 Mb
PubMed search[3][4]
Wikidata
View/Edit HumanView/Edit Mouse

Casein kinase I isoform delta also known as CKI-delta or CK1δ is an enzyme that in humans is encoded by the gene CSNK1D, which is located on chromosome 17 (17q25.3). It is a member of the CK1 (formerly named casein kinase 1) family of serine/threonine specific eukaryotic protein kinases encompassing seven distinct isoforms (CK1α, γ1-3, δ, ε) as well as various post-transcriptionally processed splice variants (transcription variants, TVs) in mammalians.[5][6][7] Meanwhile, CK1δ homologous proteins have been isolated from organisms like yeast, basidiomycetes, plants, algae, and protozoa.[8][9][10][11][12][13][14]

Genetic coding

In 1993, the gene sequence of CK1δ was initially described by Graves et al. who isolated the cDNA from testicles of rats. After sequencing and characterization of the gene, the construct was described as a 1284 nucleotide sequence resulting in a protein consisting of 428 amino acids after transcription. The molecular weight of the according protein was published as 49 kDa.[15] Three years later, the same gene was identified in humans. The human CSNK1D contains 1245 nucleotides and is transcribed into a protein consisting of 415 amino acids.[16]

Ever since, CK1δ was investigated and described in various animals, plants, as well as parasites (Caenorhabditis elegans, 1998;[17] Drosophila melanogaster, 1998;[18] Mus musculus, 2002;[19] Xenopus laevis, 2002.[20])

Transcriptional variants

So far, three different transcription variants (TVs) have been described for CK1δ in humans (Homo sapiens), mice (Mus musculus), and rats (Rattus norvegicus), which are highly homologous. The alignment of all CK1δ sequences of all organisms shows a high homology in the first 399 amino acids, except for position 381. While the human transcription variants are using isoleucine, the mouse and rat sequences incorporate a valine instead. The only exception is rat TV3, which is also transcribing its nucleotide sequence into an isoleucine.

After position 399, three different general structures can be observed. The first variant consists of 415 amino acids across all three organisms and is called TV1 in human and rat, while the murine counterpart is named CRAa. The shortest group of sequences consists of 409 amino acids: TV2 in humans and rats, CRAc in mice. The longest variant consists of 428 amino acids in rat (TV3) and mice (CRAb), while the human (TV3) variant is missing the second to last amino acid (threonine), resulting in a protein of a length of 427 amino acids.

The various transcription variants are based on a different usage of the exons that are encoding for CSNK1D. The whole gene consists of eleven different exons and is located in humans on chromosome 17 at position 17q25.3. CSNK1D has a length of 35kb and is overlapping with the gene Slc16a3. The intersecting part is exon 11, which is located downstream of exon 10. However, it does not interfere with Slc16a3 since it is located in a non-coding area.

TV1 and TV2 were postulated during an early analysis of human and murine genes in 2002.[21] Both transcription variants share the first 399 amino acids, but differ at the following 16 amino acids for TV1 and ten amino acids for TV2, respectively. This is linked to the exon usage. While they share the first eight exons, TV1 is using exon 10and TV2 exon 9 to finish their respective sequence. The third transcription variant was postulated after a data bank analysis in the year 2014.[22] The proposed sequence is sharing the first 399 amino acids with TV1 and TV2, but differs in the upcoming 28 amino acids. The exon usage of TV3 consists of exon 1 to 8, which is followed by exon 11 to finish the sequence.

Besides various sequences of the three different transcription variants, the variants also show differences in Michaelis-Menten kinetic parameters (Km and Vmax) in regard to their potential to phosphorylate canonical (α-casein) as well as non-canonical (GST-β-catenin1-181) substrates (Xu et al., 2019). TV3 shows an increase of phosphorylation of both substrates compared to TV1 and TV2, which is statistically significant. These differences can be explained by various degrees of autophosphorylation of the transcription variants.[23]

Polyadenylation

Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants .[24] TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site,[25] this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.

Structure

Figure 1: Three-dimensional structure of human CK1δ. While the structure of the N-lobe mainly consists of β-sheet strands, the larger C-terminal lobe is mainly composed by α-helices and loop structures. The DFG motif is located within loop L-89. A recognition motif for the binding of phosphorylated substrates has been identified by detection of a tungstate-binding domain, indicated by W1. The position of the catalytic loop (L-67) is marked with the asterisk.[26][27] The figure was created by using CK1δ crystallization data created by Ben-neriah et al.,[28] deposited in the protein data bank (PDB) with ID 6GZM.

Like eukaryotic protein kinases (ePKs) the different isoforms of the CK1 family consist of a N-terminal and a C-terminal lobe (N- and C-lobe, respectively), which are connected via a hinge region. While the N-lobe is mainly composed by β-sheet strands, the larger C-lobe predominantly consists of α-helical and loop structures. Between both lobes a catalytic cleft is formed, accommodating substrates and ATP for the kinase reaction.[26][27]

Binding of substrates and co-substrates

Binding of phosphorylated substrates to distinct regions of the C-lobe has previously been detected by binding of a tungstate derivative (as a phosphate analog). Instead of phospho-primed substrate also the C-terminal regulatory domain of CK1δ is able to bind to this position for the purpose of autoregulatory function.[26] Binding of ATP is mainly mediated via the glycine-rich P-loop (L-12, bridging strands β1 and β2), forming the top cover of the WTP binding site, and the so-called catalytic loop (L-67).[29][27][30] Conformational changes affecting the activation loop (L-9D) are related to regulation of kinase activity. When the activation loop moves out of the catalytic site the catalytically relevant DFG motif (Asp-149, Phe-150, and Gly-151) shifts to an internal position. The aspartate residue chelates a Mg2+ ion allowing proper binding and orientation of ATP.[31][26][27] Another residue, which is essentially involved in the regulation of kinase activity, but also in forming interactions with small molecule inhibitors, is Met-82, the so-called gatekeeper residue. Directly located within the ATP binding pocket this residue controls access of small molecules to certain binding pockets (selectivity pockets) located beyond the position of the gatekeeper.[32]

Additional functional domains

Apart from domains directly involved in catalytic activity further functional domains are present in the CK1δ protein. A kinesin homology domain (KHD) as well as a putative dimerization domain (DD) can be found in the kinase domain.[33] While the KHD allows CK1 isoforms to interact with components of the cytoskeleton.[34][35][27] the DD is supposed to be involved in regulation of kinase activity (see below). In the C-lobe, furthermore, a nuclear localization signal (NLS) as well as a centrosome localization signal (CLS) can be found. However, the first one is not sufficient to locate CK1δ to the nucleus.[15][36][37]

Regulation of expression and activity

Rigorous control of CK1δ expression and kinase activity is crucial due to its involvement in important cellular signal transduction pathways. Generally, basal expression levels of CK1δ differ between various tissues, cell types, and physiological circumstances.[38] Increased expression levels of CK1δ mRNA can be detected after treatment of cells with DNA-damaging substances, like etoposide and camptothecin, or by γ-irradiation, while increased CK1-specific activity is observed after stimulation of cells with insulin or after viral transformation.[34][39][40][41]

Subcellular sequestration

On protein level, CK1δ activity can be regulated by sequestration to particular subcellular compartments bringing the kinase together with distinct pools of substrates in order to guide its cellular function.[42][43][13] This sequestration is usually facilitated by scaffolding proteins, which are also supposed to allosterically control the activity of the interacting kinase.[44][45] For CK1δ subcellular sequestration has been described to be mediated by A-kinase anchor protein (AKAP) 450, the X-linked DEAD-box RNA helicase 3 (DDX3X), casein kinase-1 binding protein (CK1BP), and the regulatory and complex-building/-initiating molecule 14-3-3 ζ.[46][47][36][42][48][49] AKAP450 recruits CK1δ and ε to the centrosome to exert centrosome-specific functions in the context of cell cycle regulation.[36][42] DDX3X promotes CK1ε-mediated phosphorylation of Dishevelled (Dvl) in the canonical Wnt pathway but has also been demonstrated to stimulate CK1δ- and ε-specific kinase activity by up to five orders of magnitude.[46][50] On the contrary, proteins being homologous to CK1BP (e.g. dysbindin or BLOC-1 [biogenesis of lysosome-related organelles complex-1]) are able to inhibit CK1δ kinase activity in a dose dependent manner.[48]

Dimerization

Dimerization of CK1δ has also been described as a regulatory mechanism through the interaction interface contained by the DD of CK1δ. Following dimerization, Arg-13 inserts into the adenine binding pocket and prevents binding of ATP and perhaps also of large substrates. Although CK1δ in solution is always purified as monomers, biological relevance of dimerization could be demonstrated by showing that the binding of dominant-negative mutant CK1δ to wild type CK1δ resulted in the total reduction of CK1δ-specific kinase activity.[51][33][52]

Site-specific phosphorylation

Figure 2: Posttranslational modification of human CK1δ. Identified posttranslational modifications of CK1δ TV1 are indicated at their reported positions. Because most modifications have been reported for the C-terminal domain, this domain is depictured in a stretched presentation compared to the kinase domain. In the case of phosphorylation the distinction is made between reports of low-throughput studies (LTP) and high-throughput studies (HTP). Autophosphorylated residues within the autoinhibitory domain are shown in red. Kinases identified to phosphorylate certain residues are indicated above the respective target site. Names of kinases are parenthesized in case final confirmation is pending. Information about detected ubiquitylation, acetylation, and methylation events is also provided, although up to now no specific functions have been linked to the observed modifications. The figure was created based on information provided for CK1δ by PhosphoSitePlus.[53]

Posttranslational modifications, especially site-specific phosphorylation mediated either by upstream kinases or by intramolecular autophosphorylation, have been demonstrated to reversibly modulate CK1δ kinase activity. Several residues within the C-terminal regulatory domain of CK1δ were identified as targets for autophosphorylation, including Ser-318, Thr-323, Ser-328, Thr-329, Ser-331, and Thr-337. Upon autophosphorylation sequence motifs within the C-terminal domain are generated, which are able to block the catalytic center of the kinase by acting as a pseudosubstrate.[54][55] Regulatory function of the C-terminal domain has furthermore been confirmed by the observation that kinase activity is increased after proteolytic cleavage of this domain.[56][54]

Besides autophosphorylation, site-specific phosphorylation by other cellular kinases has been demonstrated to regulate kinase activity. So far, C-terminal phosphorylation of CK1δ by upstream kinases has been confirmed for protein kinase A (PKA), protein kinase B (Akt), cyclin-dependent kinase 2/cyclin E (CDK2/E) and cyclin-dependent kinase 5/p35 (CDK5/p35), CDC-like kinase 2 (CLK2), protein kinase C α (PKCα), and checkpoint kinase 1 (Chk1).[23][57][58][59][60] For several phosphorylation events also effects on kinase function have been described. For residue Ser-370, which can be phosphorylated at least by PKA, Akt, CLK2, PKCα and Chk1, major regulatory function has been demonstrated. As a consequence of altered kinase activity of a CK1δ S370A mutant, subsequently affected Wnt/β-catenin signal transduction resulted in development of an ectopic dorsal axis in Xenopus laevis embryos.[58] Further residues targeted by site-specific phosphorylation are depicted in Figure 2. Mutation of identified target sites to the non-posphorylatable amino acid alanine leads to significant effects on catalytic parameters of CK1δ in most cases, at least in vitro.[23][59][60]

Evidence was also generated in cell culture-based analyses, which show reduced CK1-specific kinase activity after activation of cellular Chk1, and increased activity of CK1 after treatment of cells with the PKC-specific inhibitor Gö-6983 or the pan-CDK inhibitor dinaciclib.[23][59][60] These findings indicate, that site-specific phosphorylation mediated by Chk1, PKCα, and CDKs actually results in reduced cellular CK1-specific kinase activity. However, robust in vivo phosphorylation data are missing in most cases and biological relevance and functional consequences of site-specific phosphorylation remains to be investigated for in vivo conditions. Moreover, phosphorylation target sites within the kinase domain have not been extensively characterized yet and are object to future research.

Substrates

So far, more than 150 proteins have been identified to be targets for CK1-mediated phosphorylation, at least in vitro. Phosphorylation of numerous substrates is enabled due to the existence of several consensus motifs, which can be recognized by CK1 isoforms.

Canonical consensus motif

CK1δ preferably interacts with phospho-primed or acidic substrates due to the localization of positively charged amino acids (e.g. Arg-178 and Lys-224) in the region involved in substrate recognition.[26] The canonical consensus motif targeted by CK1 is represented by the sequence pSer/pThr-X-X-(X)-Ser/Thr. In this motif X stands for any amino acid while pSer/pThr indicates a previously phosphorylated serine or threonine residue. CK1-mediated phosphorylation occurs at the Ser/Thr downstream of the phospho-primed residue. However, instead of a primed residue also a cluster of negatively charged amino acid residues (Asp or Glu) can be included in the canonical consensus motif.[61][62][63][64]

Non-canonical consensus motif

As a first non-canonical consensus motif targeted by CK1δ the so-called SLS motif (Ser-Leu-Ser) has been described, which can be found in β-catenin and nuclear factor of activated T-cells (NFAT).[65] In several sulfatide and cholesterol-3-sulfate (SCS)-binding proteins the consensus motif Lys/Arg-X-Lys/Arg-X-X-Ser/Thr has been identified and phosphorylation of this motif has been demonstrated for myelin basic protein (MBP), the Ras homolog family member A (RhoA), and tau.[66]

Subcellular localization

Within living cells CK1δ can be detected in both, the cytoplasm and the nucleus, and increased levels of CK1δ can be found in close proximity to the Golgi apparatus and the trans Golgi network (TGN). Temporarily, CK1δ can also be localized to membranes, receptors, transport vesicles, components of the cytoskeleton, centrosomes or spindle poles.[34][67][38][68][69][70] While the present NLS is not sufficient for nuclear localization of CK1δ, the presence of the kinase domain and even its enzymatic activity are needed for proper subcellular localization of CK1δ.[15][71][68]

Interaction with cellular proteins

Localization of CK1δ to certain subcellular compartments can furthermore be initiated by its interaction with cellular proteins. In order to mediate interaction with CK1δ appropriate docking motifs need to be present in the respective proteins. Docking motif Phe-X-X-X-Phe has been identified in NFAT, β-catenin, PER, and proteins of the FAM83 family.[72][73][74][75][76][77][78][79] As an example, nuclear CK1δ can be localized to nuclear speckles by its interaction with FAM83H.[76][80] Another interaction motif is represented by the sequence Ser-Gln-Ile-Pro, which is present in microtubule plus-end-binding protein 1 (EB1).[81] Numerous interaction partners for CK1δ have been described within recent years, forming strong interactions with CK1δ and therefore being more than simple substrate proteins. As mentioned above, interactions with CK1δ have been shown for AKAP450 and DDX3X. By initially performing yeast two-hybrid screens, interaction could also be confirmed for the Ran-binding protein in the microtubule-organizing center (RanBPM), microtubule-associated protein 1A, and snapin, a protein associated with neurotransmitter release in neuronal cells.[82][83] Interactions with CK1δ have also been detected for the development-associated factors LEF-1 (lymphocyte enhancer factor-1) and the proneural basic helix-loop-helix (bHLH) transcription factor Atoh1.[84][85] Finally, interaction of CK1δ with PER and CRY circadian clock proteins have been demonstrated, facilitating nuclear translocation of PERs and CRYs.[77]

Cellular functions

Circadian rhythm

Wikipathway: Circadian Clock (Homo sapiens). Whole Pathway can be seen at: https://www.wikipathways.org/index.php/Pathway:WP1797

CK1δ seems to be involved in the circadian rhythm, the internal cellular clock, which permits a rhythm of about 24 h. The circadian rhythm mainly consists of a negative feedback loop mediated by (PER) and cryptochrome (CRY) proteins, which can dimerize and shuttle into the nucleus.[86][77] Here, PER/CRY dimers can inhibit their own transcription, by inhibiting the CLOCK/BMAL1-responsive gene transcription.[87] Alteration of normal circadian rhythm has been observed in different diseases, among them neurological and sleeping disorders.[88][89][90][91] In the nucleus, CK1δ can further inhibit CLOCK/BMAL1-driven transcription by reducing their binding activity to DNA.[86] Moreover, CK1δ/ε can phosphorylate PER proteins and influence their further degradation.[92][77][93][94] Destabilization of the circadian rhythm can be observed after inhibition of PER phosphorylation by CK1δ/ε.[95] In fact, alterations in CK1δ activity lead to changes in the length of the circadian rhythm.[74][96][97][98][99]

DNA damage and cellular stress

CK1δ can be also activated by genotoxic stress and DNA damage in a p53-dependent manner, and phosphorylate key regulatory proteins in response to these processes.[41] CK1δ phosphorylates human p53 on Ser-6, Ser-9, and Ser-20.[100][41][101][102] Moreover, CK1δ phosphorylates p53 on Thr-18, once p53 is already phospho-primed, permitting a lower p53-Mdm2 binding and higher p53 activity.[103][104] Under normal conditions, CK1δ can phosphorylate Mdm2 on Ser-240, Ser-242, Ser-246, and Ser-383, permitting higher p53-Mdm2 stability and further p53 degradation.[105][106] On the contrary, after DNA damage, ATM phosphorylates CK1δ, which can subsequently phosphorylate Mdm2 inducing its proteasomal degradation.[107][108][109] Under hypoxia, CK1δ is involved in reducing cell proliferation by interfering with HIF-1α/ARNT complex formation.[110][111] Additionally, the activity of topoisomerase II α (TOPOII-α), one of the main regulators of DNA replication, results increased after its CK1δ-mediated phosphorylation on Ser-1106.[112] Under stress conditions, CK1δ can interfere with DNA replication. In fact, CK1δ phosphorylates a main regulator of DNA methylation, the ubiquitin-like containing PHD and RING finger domains 1 protein (UHRF1), on Ser-108, increasing its proteasomal degradation.[113]

Cell cycle, mitosis and meiosis

CK1δ is involved in microtubule dynamics, cell cycle progression, genomic stability, mitosis and meiosis.[114][115][67][116][117][118][119][120][42] Transient mitotic arrest, can be observed after CK1δ inhibition with IC261,[121] even though this inhibitor have recently been shown not to be CK1-specific and to have many additional off-target [122][69] Nevertheless, in line with these results, CK1δ inhibition or silencing allows Wee1 stability and subsequent Cdk1 phosphorylation which permits cell cycle exit.[118][117] Absence of CK1δ has been also associated with genomic instability.[115] Nevertheless, the role of CK1δ in mitosis is still unclear and contrary reports have been published.[123][114]

CK1δ seems also to be involved in meiosis. Hrr25, the CK1δ orthologue in Saccharomyces cerevisiae, can be found localized to P-bodies – RNA/protein granules identified in cytoplasm of meiotic cells – and seems to be necessary for meiosis progression.[124][125] Furthermore, Hrr25 was observed to have a role in nuclear division and membrane synthesis during meiosis II.[126] In Schizosaccharomyces pombe, the CK1δ/ε orthologue Hhp2 promotes the cleavage of cohesion protein Rec8 possibly after its phosphorylation during meiosis.[127][128][129] Moreover, phosphorylation of STAG3, the mammalian orthologue of Rec11, by CK1 could be also observed, confirming a possible conservation of this process also in mammals.[119][120]

Cytoskeleton associated functions

CK1δ is involved in the regulation of microtubule polymerization and stability of the spindle apparatus and centrosomes during mitosis by directly phosphorylating α-, β-, and γ-tubulin.[34][130] Additionally, CK1δ can also phosphorylate microtubule-associated proteins (MAPs) thereby influencing their interaction with microtubules as well as microtubule dynamics.[34][131][132][133][134][83]

Developmental pathways

Wikipathways: Wnt Signaling Pathway (Homo sapiens). Whole Pathway can be seen at: https://www.wikipathways.org/index.php/Pathway:WP363

CK1δ is involved in different developmental pathways, among them Wingless (Wnt)-, Hedgehog (Hh)-, and Hippo (Hpo)-pathways. In the Wnt pathway, CK1δ can phosphorylate different factors of the pathway, among them Dishevelled (Dvl), Axin, APC, and β-catenin.[135][136][137][138] CK1δ also negatively influences the stability of β-catenin, after its phosphorylation on Ser-45, which permits GSK3β-mediated further phosphorylations and subsequent degradation.[135]

Wikipathways: Hedgehog Signaling Pathway (Homo sapiens). Whole Pathway can be seen at: https://www.wikipathways.org/index.php/Pathway:WP4249

In the Hh pathway, CK1δ can phosphorylate Smothened (Smo) thereby enhancing its activity.[139] Moreover, its additional role in this signaling pathways is still controversial. In fact, on one hand CK1δ can phosphorylate Cubitus interruptus activator (CiA) thereby avoiding its proteasomal degradation,[140] while on the other hand CK1δ-mediated phosphorylation of Ci can increase its ubiquitination [141] and its partial proteolysis into the repressive form of Ci (CiR).[142]

In the Hpo pathway, CK1δ can phosphorylate yes-associated protein (YAP), the down-stream co-activator of Hpo-responsive gene transcription on Ser-381, which influences its proteasomal degradation.[143] Moreover, the Hpo signaling pathway seems to be related with both, Wnt signaling.[144][145][146][147][148][149][150][151][152] and p53 regulation [153][154] In presence of Wnt ligand, CKδ/ε can phosphorylate the key Wnt-effector Dishevelled (Dvl) which inhibits the β-catenin destruction complex finally resulting in a higher stability of β-catenin. Here, YAP/Tafazzin (TAZ) can bind Dvl and reducing its CK1δ-mediated phosphorylation.[147][151] Additionally, β-catenin can be retained into the cytoplasm after binding to YAP, which results in lower transcription of Wnt-responsive genes.[146][147]

Clinical significance

Within this section, the function of CK1δ in the occurrence, development and progress of several diseases and disorders mainly on cancers, neurological diseases and metabolic diseases will be discussed.

Carcinogenesis

Deregulation of CK1δ contributes to tumorigenesis and tumor progression through deregulation of Wnt/β-catenin-, p53-, Hedgehog-, and Hippo-related signaling. CK1δ mRNA is overexpressed in various cancer entities, among them bladder cancer, brain cancer, breast cancer, colorectal cancer, kidney cancer, lung adenocarcinoma, melanoma, ovarian cancer, pancreatic cancer, prostate cancer, hematopoietic malignancies and lymphoid neoplasms.[155][156][157][130][158] Also decreased CK1δ mRNA expression levels have been observed in some cancer studies, like urinary bladder cancer, lung squamous cell carcinoma, stomach cancer, kidney cancer, esophageal cancer as well as head and neck cancer.[157] Besides those, reduced CK1δ activity owing to the site N172D mutation of CK1δ decelerated mammary carcinoma progression, and prolonged mouse survival in a transgenic mouse model.[51] The two CK1δ mutations, R324H and T67S identified in intestinal mucosa and in a colorectal tumor, respectively, exhibit increased carcinogenic potential.[159][160]

Neuropathy and neurological diseases

Abnormal expression of CK1δ in brain tissue has been found in many diseases by immunohistochemistry and gene expression studies, like Alzheimer's disease, Down syndrome, progressive supranuclear palsy, parkinsonism dementia complex of Guam (PDC), Pick's disease, pallido-ponto-nigral degeneration (PPND) and Familial advanced sleep phase syndrome.[8][161][94]

In typical pathological tissues neuritic plaques (NPs) or granulovacuolar degeneration bodies (GVBs) of AD show high expression of CK1δ, whereas in neurofibrillary tangles (NFTs) expression of CK1δ is low.[162] The AD hallmark proteins tau in NFTs or GVBs and TAR DNA-binding protein of 43 kDa (TDP-43) in GVBs colocalize with CK1δ.[163][164] In vitro phosphorylation studies revealed that several sites within tau and TDP-43 were phosphorylated by CK1δ.[165][134] Reduction of site-specific phosphorylation of TDP-43 by inhibition of CK1δ in both, a neuronal cell model as well as in a Drosophila model resulted in prevention of neurotoxicity and consequently to rescue of cells from cell death.[166] Based on these studies, CK1δ could be recognized as a hallmark as well as a potential target for AD treatment and may be further useful for diagnostic and therapeutic purpose in the future. In addition, CK1δ plays a regulatory role in Parkinson's disease (PD) by phosphorylating α-synuclein.[167] Familial advanced sleep phase syndrome (FASPS) is another neurological disease associated with CK1δ-mediated phosphorylation of the mammalian clock protein PER2. After site-specific phosphorylation by CK1δ, the stability of PER2 is increased and half-life of PER2 is expanded.[168] Furthermore, PER2 stability can be influenced by CK1δ T344A mutation and site-specific phosphorylation of CK1δ at Thr-347 by other intracellular kinases.[57]

CK1δ may affect metabolic dysfunction especially in obese situation by improving glucose tolerance, decreasing gluconeogenesis gene expression and glucose secretion or increasing basal and insulin-stimulated glucose uptake.[169][170] Furthermore, formation of the biologically active higher molecular weight (HMW) form of adiponectin, which is involved in regulating glucose levels and fatty acid secreted from adipose tissue, is modulated by site-specific phosphorylation of adiponectin by CK1δ.[171]

Parasitic CK1s hijack mammalian CK1 pathways

Increasing evidence suggests that CK1 can be associated with infectious diseases by the manipulation of the CK1-related signaling pathways of the host cell by intracellular parasites, exporting their CK1 into the host cell. For Leishmania and Plasmodium, excreted CK1 contributes to reprogramming of the respective host cells.[172][173][174][175][176] Possessing host functions parasitic CK1s are able to replace mammalian CK1s, thereby ensuring similar functions.[177] Parasitic CK1s display a high level of identity towards human CK1δ TV1, suggesting that this human paralogue might be the preferred target for parasitic hijacking.[178] The protein organization of parasitic CK1s is very similar to that of human CK1δ. All residues involved in ATP binding, the gatekeeper residue, as well as the DFG, KHD, and SIN motifs are generally conserved in parasitic CK1 sequences. This finding suggests, that they are crucial for CK1 function. However, the functions of these kinases in the parasites and more importantly their functions in the host cell are mainly unknown and remain to be investigated. CK1s from Plasmodium and Leishmania are most studied:

  • The only CK1 in Plasmodium, PfCK1 (PF3D7_1136500), presents 69% of identity with human CK1 within the kinase domain and is essential for completion of the asexual intra-erythrocytic cycle.[179][180] Similar to other CK1s, also PfCK1 has multiple binding partners and thus potentially regulates multiple pathways, including those regulating transcription, translation, and protein trafficking. Finally, PfCK1 seems to be essential for parasite proliferation in erythrocytes.
  • From the six CK1 paralogues in Leishmania donovani only two paralogs, LdBPK_351020.1 and LdBPK_351030.1 (LmCK1.2), are closely related to human CK1.[181] The only paralog described as having a function in the host cell.[176] LdBPK_351030.1 is active in both promastigotes and amastigotes. LmCK1.2 can be inhibited by the CK1-specific inhibitor D4476 and is important for intracellular parasite survival.[178] So far, only few substrates for LmCK1.2 have been identified and the functions of LmCK1.2 in the parasite are poorly studied.[182] Although LmCK1.2 is highly identic to human CK1, several small molecules have been identified to specifically target Leishmania CK1, thereby providing opportunities for new therapeutic strategies.[183][184][185]

Modulating CK1δ activity

Due to the fact that CK1δ is involved in regulation of various cellular processes there is high attempts to influence its activity. Since changes of the expression and/or activity as well as the occurrence of mutations within the coding sequence of CK1δ account to the development of various diseases, among them cancer and neurodegenerative diseases like AD, ALS, PD and sleeping disorders, most interest has first concentrated on the development of CK1δ specific small molecule inhibitors (SMIs). Due to the fact, that CK1δ mutants isolated from different tumor entities often exhibit a higher oncogenic potential than wild type CK1δ there are also great efforts to generate SMIs which are more selective inhibiting CK1δ mutants than wild type CK1δ. These SMIs would be of high clinical interest as they would increase the therapeutic window and reduce therapeutic side effects for the treatment of proliferative and neurodegenerative diseases. However, development of CK1δ specific inhibitors is very challenging due to several reasons: (i) So far, most of the developed inhibitors are classified as ATP-competitive inhibitors exhibiting off target effects mainly due to structural similarities of the ATPbinding site of CK1δ to those of other kinases and ATP-binding proteins, (ii) site specific phosphorylation of CK1δ, especially within its C-terminal regulatory domain, often increases the IC50 value of CK1δ specific inhibitors, and (iii) due to their hydrophobic character their bioavailability is often very low. Within the last few years several SMIs with a much higher selectivity towards CK1δ than to other CK1 isoforms have been described which are also effective in animal models. Treatment of rats, mice, monkeys and zebrafishes with PF-670462 (4-[3-cyclohexyl-5-(4-fluoro-phenyl)-3H-imidazol-4-yl]-pyrimidin-2-ylamine) results in a phase shift in circadian rhythm.[186][187][188][189][190][191] Furthermore, it blocks amphetamine-induced locomotion in rats,[192] prevents the alcohol deprivation effect in rat,[193] and inhibits acute and chronic bleomycin-induced pulmonary fibrosis in mice.[194] PF-670462 also stalls deterioration caused by UVB eye irradiation in a mouse model of ulcerative colitis,[195] and reduces the accumulation of leukemic cells in the peripheral blood and spleen in a mouse model for Chronic lymphocytic leukemia (CLL). PF-5006739, 4-[4-(4-fluorophenyl)-1-(piperidin-4-yl)-1H-imidazol-5-yl]pyrimidin-2-amine derivative attenuate the opioid drug-seeking behavior in rodents. Furthermore, it leads to a phase delay of circadian rhythm in nocturnal and diurnal animal models. N-benzothiazolyl-2-phenyl acetamide derivatives developed by Salado and co-workers show protective effects on in vivo hTDP-43 neurotoxicity in Drosophila.[196]

Interestingly, inhibitors of Wnt production (IWPs), known to inhibit O-acyltransferase porcupine (Porcn) and to be antagonists of the Wnt pathway, show structural similarities to benzimidazole-based CK1 inhibitors, among them Bischof-5 [197] and are therefore highly potent in specifically inhibiting CK1δ. Further development of IWP derivatives resulted in improved IWP-based ATP-competitive inhibitors of CK1δ. In summary, it can be concluded that the cellular effects mediated by IWPs are not only due to the inhibition of Porcn, but also to inhibition of CK1δ dependent signaling pathways.[198] These data clearly show a high potential of CK1δ specific inhibitors for personalized therapy concepts for the treatment of various tumor entities (e.g. breast cancer, colorectal cancer, and glioblastoma), leukemia, neurodegenerative disease like AD, PD, and ALs, and sleeping disorders. Furthermore, CK1δ specific inhibitors seem to exhibit high relevance for prognostic applications. In this context [11C] labeled highly potent difluoro-dioxolo-benzoimidazol-benzamides can be used as PET radiotracers and for imaging of AD.[199]

Since small molecule inhibitors often have various disadvantages, including low bioavailability, off-target effects as well as severe side effects, the interest in the development and validation of new biological tools like identification of biological active peptides either able to inhibit CK1δ activity or the interaction of CK1δ with cellular proteins is more and more growing. The use of peptide libraries resulted in the identification of peptides able to specifically block the interaction of CK1δ with tubulin, the RNA helicase DDX3X and Axin.[200][201][202] Binding of peptide δ-361 to α-tubulin not only lead to blocking of the interaction of CK1δ with α-tubulin, it also selectively inhibited phosphorylation of GST-α-tubulin by CK1δ. Treatment of cancer cells with peptide δ-361 finally resulted to microtubule destabilization and cell death.[202] Fine-mapping of the DDX3X interaction domains on CK1δ, the CK1δ- peptides δ-1, and δ-41 were identified to be able to block the interactions of CK1δ with the X-linked DEAD box RNA helicase DDX3X as well as the kinase activity of CK1δ. In addition, these two identified peptides could inhibit the stimulation of CK1 kinase activity in established cell lines. Since DDX3X mutations being present in medulloblastoma patients increase the activity of CK1 in living cells, and subsequently activate CK1-regulated pathways like Wnt/β-catenin and hedgehog signaling, the identified interaction-blocking peptides could be useful in personalized therapy concepts for the treatment of Wnt/β-catenin- or Hedgehog-driven cancers.[200] In 2018, the interaction between Axin1, a scaffold protein exhibiting important roles in Wnt signaling, and CK1δ/ε were fine-mapped using a peptide library. The identified Axin1 derived peptides were able to block the interaction with CK1δ/ε. Since Axin1 and Dvl also compete for CK1δ/ε-mediated site-specific phosphorylation it can be stated that Axin 1 plays an important role of in balancing CK1δ/ε mediated phosphorylation of Dvl as well as for the activation of canonical Wnt signaling.[201]

See also

Notes

References

  1. ^ a b c GRCh38: Ensembl release 89: ENSG00000141551 – Ensembl, May 2017
  2. ^ a b c GRCm38: Ensembl release 89: ENSMUSG00000025162 – Ensembl, May 2017
  3. ^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. ^ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. ^ Burzio V, Antonelli M, Allende CC, Allende JE (2002). "Biochemical and cellular characteristics of the four splice variants of protein kinase CK1alpha from zebrafish (Danio rerio)". Journal of Cellular Biochemistry. 86 (4): 805–14. doi:10.1002/jcb.10263. PMID 12210746. S2CID 25667680.
  6. ^ Fu Z, Chakraborti T, Morse S, Bennett GS, Shaw G (October 2001). "Four casein kinase I isoforms are differentially partitioned between nucleus and cytoplasm". Experimental Cell Research. 269 (2): 275–86. doi:10.1006/excr.2001.5324. PMID 11570820.
  7. ^ Green CL, Bennett GS (August 1998). "Identification of four alternatively spliced isoforms of chicken casein kinase I alpha that are all expressed in diverse cell types". Gene. 216 (1): 189–95. doi:10.1016/S0378-1119(98)00291-1. PMID 9766967.
  8. ^ a b DeMaggio AJ, Lindberg RA, Hunter T, Hoekstra MF (August 1992). "The budding yeast HRR25 gene product is a casein kinase I isoform". Proceedings of the National Academy of Sciences of the United States of America. 89 (15): 7008–12. Bibcode:1992PNAS...89.7008D. doi:10.1073/pnas.89.15.7008. PMC 49634. PMID 1495994.
  9. ^ Dhillon N, Hoekstra MF (June 1994). "Characterization of two protein kinases from Schizosaccharomyces pombe involved in the regulation of DNA repair". The EMBO Journal. 13 (12): 2777–88. doi:10.1002/j.1460-2075.1994.tb06571.x. PMC 395157. PMID 8026462.
  10. ^ Gross SD, Anderson RA (November 1998). "Casein kinase I: spatial organization and positioning of a multifunctional protein kinase family". Cellular Signalling. 10 (10): 699–711. doi:10.1016/S0898-6568(98)00042-4. PMID 9884021.
  11. ^ Kearney PH, Ebert M, Kuret J (August 1994). "Molecular cloning and sequence analysis of two novel fission yeast casein kinase-1 isoforms". Biochemical and Biophysical Research Communications. 203 (1): 231–6. Bibcode:1994BBRC..203..231K. doi:10.1006/bbrc.1994.2172. PMID 8074660.
  12. ^ Walczak CE, Anderson RA, Nelson DL (December 1993). "Identification of a family of casein kinases in Paramecium: biochemical characterization and cellular localization". The Biochemical Journal. 296 (3): 729–35. doi:10.1042/bj2960729. PMC 1137756. PMID 8280070.
  13. ^ a b Wang PC, Vancura A, Mitcheson TG, Kuret J (March 1992). "Two genes in Saccharomyces cerevisiae encode a membrane-bound form of casein kinase-1". Molecular Biology of the Cell. 3 (3): 275–86. doi:10.1091/mbc.3.3.275. PMC 275529. PMID 1627830.
  14. ^ Wang Y, Liu TB, Patel S, Jiang L, Xue C (November 2011). "The casein kinase I protein Cck1 regulates multiple signaling pathways and is essential for cell integrity and fungal virulence in Cryptococcus neoformans". Eukaryotic Cell. 10 (11): 1455–64. doi:10.1128/EC.05207-11. PMC 3209051. PMID 21926330.
  15. ^ a b c Graves PR, Haas DW, Hagedorn CH, DePaoli-Roach AA, Roach PJ (March 1993). "Molecular cloning, expression, and characterization of a 49-kilodalton casein kinase I isoform from rat testis". The Journal of Biological Chemistry. 268 (9): 6394–401. doi:10.1016/S0021-9258(18)53265-8. PMID 8454611.
  16. ^ Kusuda J, Hidari N, Hirai M, Hashimoto K (February 1996). "Sequence analysis of the cDNA for the human casein kinase I delta (CSNK1D) gene and its chromosomal localization". Genomics. 32 (1): 140–3. doi:10.1006/geno.1996.0091. PMID 8786104.
  17. ^ The C. Elegans Sequencing Consortium (December 1998). "Genome sequence of the nematode C. elegans: a platform for investigating biology". Science. 282 (5396): 2012–8. Bibcode:1998Sci...282.2012.. doi:10.1126/science.282.5396.2012. PMID 9851916.
  18. ^ Kloss B, Price JL, Saez L, Blau J, Rothenfluh A, Wesley CS, Young MW (July 1998). "The Drosophila clock gene double-time encodes a protein closely related to human casein kinase Iepsilon". Cell. 94 (1): 97–107. doi:10.1016/S0092-8674(00)81225-8. PMID 9674431. S2CID 15931992.
  19. ^ Mural RJ, Adams MD, Myers EW, Smith HO, Miklos GL, Wides R, et al. (May 2002). "A comparison of whole-genome shotgun-derived mouse chromosome 16 and the human genome". Science. 296 (5573): 1661–71. Bibcode:2002Sci...296.1661M. doi:10.1126/science.1069193. PMID 12040188. S2CID 4494686.
  20. ^ Klein SL, Strausberg RL, Wagner L, Pontius J, Clifton SW, Richardson P (December 2002). "Genetic and genomic tools for Xenopus research: The NIH Xenopus initiative". Developmental Dynamics. 225 (4): 384–91. doi:10.1002/dvdy.10174. PMID 12454917. S2CID 26491164.
  21. ^ Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, et al. (December 2002). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proceedings of the National Academy of Sciences of the United States of America. 99 (26): 16899–903. Bibcode:2002PNAS...9916899M. doi:10.1073/pnas.242603899. PMC 139241. PMID 12477932.
  22. ^ Ezkurdia I, Juan D, Rodriguez JM, Frankish A, Diekhans M, Harrow J, Vazquez J, Valencia A, Tress ML (November 2014). "Multiple evidence strands suggest that there may be as few as 19,000 human protein-coding genes". Human Molecular Genetics. 23 (22): 5866–78. doi:10.1093/hmg/ddu309. PMC 4204768. PMID 24939910.
  23. ^ a b c d Bischof J, Randoll SJ, Süßner N, Henne-Bruns D, Pinna LA, Knippschild U (2013). "CK1δ kinase activity is modulated by Chk1-mediated phosphorylation". PLOS ONE. 8 (7) e68803. Bibcode:2013PLoSO...868803B. doi:10.1371/journal.pone.0068803. PMC 3701638. PMID 23861943.
  24. ^ Chang TH, Huang HY, Hsu JB, Weng SL, Horng JT, Huang HD (2013). "An enhanced computational platform for investigating the roles of regulatory RNA and for identifying functional RNA motifs". BMC Bioinformatics. 14 (Suppl 2) S4. doi:10.1186/1471-2105-14-S2-S4. PMC 3549854. PMID 23369107.
  25. ^ Klasens BI, Das AT, Berkhout B (April 1998). "Inhibition of polyadenylation by stable RNA secondary structure". Nucleic Acids Research. 26 (8): 1870–6. doi:10.1093/nar/26.8.1870. PMC 147501. PMID 9518478.
  26. ^ a b c d e Longenecker KL, Roach PJ, Hurley TD (April 1996). "Three-dimensional structure of mammalian casein kinase I: molecular basis for phosphate recognition". Journal of Molecular Biology. 257 (3): 618–31. doi:10.1006/jmbi.1996.0189. PMID 8648628.
  27. ^ a b c d e Xu RM, Carmel G, Sweet RM, Kuret J, Cheng X (March 1995). "Crystal structure of casein kinase-1, a phosphate-directed protein kinase". The EMBO Journal. 14 (5): 1015–23. doi:10.1002/j.1460-2075.1995.tb07082.x. PMC 398173. PMID 7889932.
  28. ^ Minzel W, Venkatachalam A, Fink A, Hung E, Brachya G, Burstain I, Shaham M, Rivlin A, Omer I, Zinger A, Elias S, Winter E, Erdman PE, Sullivan RW, Fung L, Mercurio F, Li D, Vacca J, Kaushansky N, Shlush L, Oren M, Levine R, Pikarsky E, Snir-Alkalay I, Ben-Neriah Y (September 2018). "Small Molecules Co-targeting CKIα and the Transcriptional Kinases CDK7/9 Control AML in Preclinical Models". Cell. 175 (1): 171–185.e25. doi:10.1016/j.cell.2018.07.045. PMC 6701634. PMID 30146162.
  29. ^ Hantschel O, Superti-Furga G (January 2004). "Regulation of the c-Abl and Bcr-Abl tyrosine kinases". Nature Reviews Molecular Cell Biology. 5 (1): 33–44. doi:10.1038/nrm1280. PMID 14708008. S2CID 7956644.
  30. ^ Zeringo NA, Murphy L, McCloskey EA, Rohal L, Bellizzi JJ (October 2013). "A monoclinic crystal form of casein kinase 1 δ". Acta Crystallographica Section F. 69 (Pt 10): 1077–83. doi:10.1107/S1744309113023403. PMC 3792660. PMID 24100552.
  31. ^ Endicott JA, Noble ME, Johnson LN (2012). "The structural basis for control of eukaryotic protein kinases". Annual Review of Biochemistry. 81: 587–613. doi:10.1146/annurev-biochem-052410-090317. PMID 22482904.
  32. ^ Peifer C, Abadleh M, Bischof J, Hauser D, Schattel V, Hirner H, Knippschild U, Laufer S (December 2009). "3,4-Diaryl-isoxazoles and -imidazoles as potent dual inhibitors of p38alpha mitogen activated protein kinase and casein kinase 1delta". Journal of Medicinal Chemistry. 52 (23): 7618–30. doi:10.1021/jm9005127. PMID 19591487.
  33. ^ a b Longenecker KL, Roach PJ, Hurley TD (May 1998). "Crystallographic studies of casein kinase I delta toward a structural understanding of auto-inhibition". Acta Crystallographica Section D. 54 (Pt 3): 473–5. Bibcode:1998AcCrD..54..473L. doi:10.1107/S0907444997011724. PMID 9761932.
  34. ^ a b c d e Behrend L, Stöter M, Kurth M, Rutter G, Heukeshoven J, Deppert W, Knippschild U (April 2000). "Interaction of casein kinase 1 delta (CK1δ) with post-Golgi structures, microtubules and the spindle apparatus". European Journal of Cell Biology. 79 (4): 240–51. doi:10.1078/S0171-9335(04)70027-8. PMID 10826492.
  35. ^ Roof DM, Meluh PB, Rose MD (July 1992). "Kinesin-related proteins required for assembly of the mitotic spindle". The Journal of Cell Biology. 118 (1): 95–108. doi:10.1083/jcb.118.1.95. PMC 2289520. PMID 1618910.
  36. ^ a b c Greer YE, Rubin JS (March 2011). "Casein kinase 1 delta functions at the centrosome to mediate Wnt-3a–dependent neurite outgrowth". The Journal of Cell Biology. 192 (6): 993–1004. doi:10.1083/jcb.201011111. PMC 3063129. PMID 21422228.
  37. ^ Hoekstra MF, Liskay RM, Ou AC, DeMaggio AJ, Burbee DG, Heffron F (August 1991). "HRR25, a putative protein kinase from budding yeast: association with repair of damaged DNA". Science. 253 (5023): 1031–4. Bibcode:1991Sci...253.1031H. doi:10.1126/science.1887218. PMID 1887218. S2CID 40543839.
  38. ^ a b Löhler J, Hirner H, Schmidt B, Kramer K, Fischer D, Thal DR, Leithäuser F, Knippschild U (2009). "Immunohistochemical characterisation of cell-type specific expression of CK1delta in various tissues of young adult BALB/c mice". PLOS ONE. 4 (1) e4174. Bibcode:2009PLoSO...4.4174L. doi:10.1371/journal.pone.0004174. PMC 2613528. PMID 19137063.
  39. ^ Cobb MH, Rosen OM (October 1983). "Description of a protein kinase derived from insulin-treated 3T3-L1 cells that catalyzes the phosphorylation of ribosomal protein S6 and casein". The Journal of Biological Chemistry. 258 (20): 12472–81. doi:10.1016/S0021-9258(17)44200-1. PMID 6313661.
  40. ^ Elias L, Li AP, Longmire J (June 1981). "Cyclic adenosine 3':5'-monophosphate-dependent and -independent protein kinase in acute myeloblastic leukemia". Cancer Research. 41 (6): 2182–8. PMID 6263462.
  41. ^ a b c Knippschild U, Milne DM, Campbell LE, DeMaggio AJ, Christenson E, Hoekstra MF, Meek DW (October 1997). "p53 is phosphorylated in vitro and in vivo by the delta and epsilon isoforms of casein kinase 1 and enhances the level of casein kinase 1 delta in response to topoisomerase-directed drugs". Oncogene. 15 (14): 1727–36. doi:10.1038/sj.onc.1201541. PMID 9349507.
  42. ^ a b c d Sillibourne JE, Milne DM, Takahashi M, Ono Y, Meek DW (September 2002). "Centrosomal anchoring of the protein kinase CK1delta mediated by attachment to the large, coiled-coil scaffolding protein CG-NAP/AKAP450". Journal of Molecular Biology. 322 (4): 785–97. doi:10.1016/S0022-2836(02)00857-4. PMID 12270714.
  43. ^ Vancura A, Sessler A, Leichus B, Kuret J (July 1994). "A prenylation motif is required for plasma membrane localization and biochemical function of casein kinase I in budding yeast". The Journal of Biological Chemistry. 269 (30): 19271–8. doi:10.1016/S0021-9258(17)32163-4. PMID 8034689.
  44. ^ Good MC, Zalatan JG, Lim WA (May 2011). "Scaffold proteins: hubs for controlling the flow of cellular information". Science. 332 (6030): 680–6. Bibcode:2011Sci...332..680G. doi:10.1126/science.1198701. PMC 3117218. PMID 21551057.
  45. ^ Locasale JW, Shaw AS, Chakraborty AK (August 2007). "Scaffold proteins confer diverse regulatory properties to protein kinase cascades". Proceedings of the National Academy of Sciences of the United States of America. 104 (33): 13307–12. Bibcode:2007PNAS..10413307L. doi:10.1073/pnas.0706311104. PMC 1948937. PMID 17686969.
  46. ^ a b Cruciat CM, Dolde C, de Groot RE, Ohkawara B, Reinhard C, Korswagen HC, Niehrs C (March 2013). "RNA helicase DDX3 is a regulatory subunit of casein kinase 1 in Wnt-β-catenin signaling". Science. 339 (6126): 1436–41. Bibcode:2013Sci...339.1436C. doi:10.1126/science.1231499. PMID 23413191. S2CID 28774104.
  47. ^ Dubois T, Rommel C, Howell S, Steinhussen U, Soneji Y, Morrice N, Moelling K, Aitken A (November 1997). "14-3-3 is phosphorylated by casein kinase I on residue 233. Phosphorylation at this site in vivo regulates Raf/14-3-3 interaction". The Journal of Biological Chemistry. 272 (46): 28882–8. doi:10.1074/jbc.272.46.28882. PMID 9360956.
  48. ^ a b Yin H, Laguna KA, Li G, Kuret J (April 2006). "Dysbindin structural homologue CK1BP is an isoform-selective binding partner of human casein kinase-1". Biochemistry. 45 (16): 5297–308. doi:10.1021/bi052354e. PMID 16618118.
  49. ^ Zemlickova E, Johannes FJ, Aitken A, Dubois T (March 2004). "Association of CPI-17 with protein kinase C and casein kinase I". Biochemical and Biophysical Research Communications. 316 (1): 39–47. Bibcode:2004BBRC..316...39Z. doi:10.1016/j.bbrc.2004.02.014. PMID 15003508.
  50. ^ Gu L, Fullam A, Brennan R, Schröder M (May 2013). "Human DEAD box helicase 3 couples IκB kinase ε to interferon regulatory factor 3 activation". Molecular and Cellular Biology. 33 (10): 2004–15. doi:10.1128/MCB.01603-12. PMC 3647972. PMID 23478265.
  51. ^ a b Hirner H, Günes C, Bischof J, Wolff S, Grothey A, Kühl M, Oswald F, Wegwitz F, Bösl MR, Trauzold A, Henne-Bruns D, Peifer C, Leithäuser F, Deppert W, Knippschild U (2012). "Impaired CK1 Delta Activity Attenuates SV40-Induced Cellular Transformation in Vitro and Mouse Mammary Carcinogenesis in Vivo". PLOS ONE. 7 (1) e29709. Bibcode:2012PLoSO...729709H. doi:10.1371/journal.pone.0029709. PMC 3250488. PMID 22235331.
  52. ^ Ye Q, Ur SN, Su TY, Corbett KD (October 2016). "Structure of the Saccharomyces cerevisiae Hrr25:Mam1 monopolin subcomplex reveals a novel kinase regulator". The EMBO Journal. 35 (19): 2139–2151. doi:10.15252/embj.201694082. PMC 5048352. PMID 27491543.
  53. ^ Hornbeck PV, Zhang B, Murray B, Kornhauser JM, Latham V, Skrzypek E (January 2015). "PhosphoSitePlus, 2014: mutations, PTMs and recalibrations". Nucleic Acids Research. 43 (Database issue): D512-20. doi:10.1093/nar/gku1267. PMC 4383998. PMID 25514926.
  54. ^ a b Graves PR, Roach PJ (September 1995). "Role of COOH-terminal phosphorylation in the regulation of casein kinase I delta". The Journal of Biological Chemistry. 270 (37): 21689–94. doi:10.1074/jbc.270.37.21689. PMID 7665585.
  55. ^ Rivers A, Gietzen KF, Vielhaber E, Virshup DM (June 1998). "Regulation of casein kinase I epsilon and casein kinase I delta by an in vivo futile phosphorylation cycle". The Journal of Biological Chemistry. 273 (26): 15980–4. doi:10.1074/jbc.273.26.15980. PMID 9632646.
  56. ^ Carmel G, Leichus B, Cheng X, Patterson SD, Mirza U, Chait BT, Kuret J (March 1994). "Expression, purification, crystallization, and preliminary x-ray analysis of casein kinase-1 from Schizosaccharomyces pombe". The Journal of Biological Chemistry. 269 (10): 7304–9. doi:10.1016/S0021-9258(17)37284-8. PMID 8125945.
  57. ^ a b Eng GW, Virshup DM (2017). "Site-specific phosphorylation of casein kinase 1 δ (CK1δ) regulates its activity towards the circadian regulator PER2". PLOS ONE. 12 (5) e0177834. Bibcode:2017PLoSO..1277834E. doi:10.1371/journal.pone.0177834. PMC 5435336. PMID 28545154.
  58. ^ a b Giamas G, Hirner H, Shoshiashvili L, Grothey A, Gessert S, Kühl M, Henne-Bruns D, Vorgias CE, Knippschild U (September 2007). "Phosphorylation of CK1delta: identification of Ser370 as the major phosphorylation site targeted by PKA in vitro and in vivo". The Biochemical Journal. 406 (3): 389–98. doi:10.1042/BJ20070091. PMC 2049039. PMID 17594292.
  59. ^ a b c Ianes C, Xu P, Werz N, Meng Z, Henne-Bruns D, Bischof J, Knippschild U (February 2016). "CK1δ activity is modulated by CDK2/E- and CDK5/p35-mediated phosphorylation". Amino Acids. 48 (2): 579–92. doi:10.1007/s00726-015-2114-y. PMID 26464264. S2CID 18593029.
  60. ^ a b c Meng Z, Bischof J, Ianes C, Henne-Bruns D, Xu P, Knippschild U (May 2016). "CK1δ kinase activity is modulated by protein kinase C α (PKCα)-mediated site-specific phosphorylation". Amino Acids. 48 (5): 1185–97. doi:10.1007/s00726-015-2154-3. PMID 26803658. S2CID 14160520.
  61. ^ Agostinis P, Pinna LA, Meggio F, Marin O, Goris J, Vandenheede JR, Merlevede W (December 1989). "A synthetic peptide substrate specific for casein kinase I". FEBS Letters. 259 (1): 75–8. Bibcode:1989FEBSL.259...75A. doi:10.1016/0014-5793(89)81498-X. PMID 2599114. S2CID 2791083.
  62. ^ Flotow H, Graves PR, Wang AQ, Fiol CJ, Roeske RW, Roach PJ (August 1990). "Phosphate groups as substrate determinants for casein kinase I action". The Journal of Biological Chemistry. 265 (24): 14264–9. doi:10.1016/S0021-9258(18)77295-5. PMID 2117608.
  63. ^ Flotow H, Roach PJ (February 1991). "Role of acidic residues as substrate determinants for casein kinase I". The Journal of Biological Chemistry. 266 (6): 3724–7. doi:10.1016/S0021-9258(19)67854-3. PMID 1995625.
  64. ^ Meggio F, Perich JW, Reynolds EC, Pinna LA (June 1991). "A synthetic beta-casein phosphopeptide and analogues as model substrates for casein kinase-1, a ubiquitous, phosphate directed protein kinase". FEBS Letters. 283 (2): 303–6. Bibcode:1991FEBSL.283..303M. doi:10.1016/0014-5793(91)80614-9. PMID 2044770. S2CID 39215819.
  65. ^ Marin O, Bustos VH, Cesaro L, Meggio F, Pagano MA, Antonelli M, Allende CC, Pinna LA, Allende JE (September 2003). "A noncanonical sequence phosphorylated by casein kinase 1 in beta-catenin may play a role in casein kinase 1 targeting of important signaling proteins". Proceedings of the National Academy of Sciences of the United States of America. 100 (18): 10193–200. Bibcode:2003PNAS..10010193M. doi:10.1073/pnas.1733909100. PMC 193538. PMID 12925738.
  66. ^ Kawakami F, Suzuki K, Ohtsuki K (February 2008). "A novel consensus phosphorylation motif in sulfatide- and cholesterol-3-sulfate-binding protein substrates for CK1 in vitro". Biological & Pharmaceutical Bulletin. 31 (2): 193–200. doi:10.1248/bpb.31.193. PMID 18239272.
  67. ^ a b Greer YE, Westlake CJ, Gao B, Bharti K, Shiba Y, Xavier CP, Pazour GJ, Yang Y, Rubin JS (May 2014). "Casein kinase 1δ functions at the centrosome and Golgi to promote ciliogenesis". Molecular Biology of the Cell. 25 (10): 1629–40. doi:10.1091/mbc.E13-10-0598. PMC 4019494. PMID 24648492.
  68. ^ a b Milne DM, Looby P, Meek DW (February 2001). "Catalytic Activity of Protein Kinase CK1δ (Casein Kinase 1δ) is Essential for itItsormal Subcellular Localization". Experimental Cell Research. 263 (1): 43–54. doi:10.1006/excr.2000.5100. PMID 11161704.
  69. ^ a b Stöter M, Krüger M, Banting G, Henne-Bruns D, Knippschild U (2014). "Microtubules depolymerization caused by the CK1 inhibitor IC261 may be not mediated by CK1 blockage". PLOS ONE. 9 (6) e100090. Bibcode:2014PLoSO...9j0090S. doi:10.1371/journal.pone.0100090. PMC 4061085. PMID 24937750.
  70. ^ Wang J, Davis S, Menon S, Zhang J, Ding J, Cervantes S, Miller E, Jiang Y, Ferro-Novick S (July 2015). "Ypt1/Rab1 regulates Hrr25/CK1δ kinase activity in ER-Golgi traffic and macroautophagy". The Journal of Cell Biology. 210 (2): 273–85. doi:10.1083/jcb.201408075. PMC 4508898. PMID 26195667.
  71. ^ LeVay S (August 1991). "A difference in hypothalamic structure between heterosexual and homosexual men". Science. 253 (5023): 1034–7. Bibcode:1991Sci...253.1034L. doi:10.1126/science.1887219. PMID 1887219. S2CID 1674111.
  72. ^ Bozatzi P, Sapkota GP (June 2018). "The FAM83 family of proteins: from pseudo-PLDs to anchors for CK1 isoforms". Biochemical Society Transactions. 46 (3): 761–771. doi:10.1042/BST20160277. PMC 6008594. PMID 29871876.
  73. ^ Bustos VH, Ferrarese A, Venerando A, Marin O, Allende JE, Pinna LA (December 2006). "The first armadillo repeat is involved in the recognition and regulation of beta-catenin phosphorylation by protein kinase CK1". Proceedings of the National Academy of Sciences of the United States of America. 103 (52): 19725–30. Bibcode:2006PNAS..10319725B. doi:10.1073/pnas.0609424104. PMC 1750875. PMID 17172446.
  74. ^ a b Etchegaray JP, Machida KK, Noton E, Constance CM, Dallmann R, Di Napoli MN, DeBruyne JP, Lambert CM, Yu EA, Reppert SM, Weaver DR (July 2009). "Casein Kinase 1 Delta Regulates the Pace of the Mammalian Circadian Clock". Molecular and Cellular Biology. 29 (14): 3853–66. doi:10.1128/MCB.00338-09. PMC 2704743. PMID 19414593.
  75. ^ Fulcher LJ, Bozatzi P, Tachie-Menson T, Wu KZ, Cummins TD, Bufton JC, Pinkas DM, Dunbar K, Shrestha S, Wood NT, Weidlich S, Macartney TJ, Varghese J, Gourlay R, Campbell DG, Dingwell KS, Smith JC, Bullock AN, Sapkota GP (May 2018). "The DUF1669 domain of FAM83 family proteins anchor casein kinase 1 isoforms". Science Signaling. 11 (531) eaao2341. doi:10.1126/scisignal.aao2341. PMC 6025793. PMID 29789297.
  76. ^ a b Kuga T, Kume H, Adachi J, Kawasaki N, Shimizu M, Hoshino I, Matsubara H, Saito Y, Nakayama Y, Tomonaga T (September 2016). "Casein kinase 1 is recruited to nuclear speckles by FAM83H and SON". Scientific Reports. 6 34472. Bibcode:2016NatSR...634472K. doi:10.1038/srep34472. PMC 5041083. PMID 27681590.
  77. ^ a b c d Lee C, Etchegaray JP, Cagampang FR, Loudon AS, Reppert SM (December 2001). "Posttranslational mechanisms regulate the mammalian circadian clock". Cell. 107 (7): 855–67. Bibcode:2001Cell..107..855L. doi:10.1016/S0092-8674(01)00610-9. PMID 11779462. S2CID 8988672.
  78. ^ Okamura H, Garcia-Rodriguez C, Martinson H, Qin J, Virshup DM, Rao A (May 2004). "A conserved docking motif for CK1 binding controls the nuclear localization of NFAT1". Molecular and Cellular Biology. 24 (10): 4184–95. doi:10.1128/MCB.24.10.4184-4195.2004. PMC 400483. PMID 15121840.
  79. ^ Vielhaber E, Eide E, Rivers A, Gao ZH, Virshup DM (July 2000). "Nuclear entry of the circadian regulator mPER1 is controlled by mammalian casein kinase I epsilon". Molecular and Cellular Biology. 20 (13): 4888–99. doi:10.1128/MCB.20.13.4888-4899.2000. PMC 85940. PMID 10848614.
  80. ^ Wang SK, Hu Y, Yang J, Smith CE, Richardson AS, Yamakoshi Y, Lee YL, Seymen F, Koruyucu M, Gencay K, Lee M, Choi M, Kim JW, Hu JC, Simmer JP (January 2016). "Fam83h null mice support a neomorphic mechanism for human ADHCAI". Molecular Genetics & Genomic Medicine. 4 (1): 46–67. doi:10.1002/mgg3.178. PMC 4707031. PMID 26788537.
  81. ^ Zyss D, Ebrahimi H, Gergely F (November 2011). "Casein kinase I delta controls centrosome positioning during T cell activation". The Journal of Cell Biology. 195 (5): 781–97. doi:10.1083/jcb.201106025. PMC 3257584. PMID 22123863.
  82. ^ Wolff S, Stöter M, Giamas G, Piesche M, Henne-Bruns D, Banting G, Knippschild U (November 2006). "Casein kinase 1 delta (CK1δ) interacts with the SNARE associated protein snapin". FEBS Letters. 580 (27): 6477–84. Bibcode:2006FEBSL.580.6477W. doi:10.1016/j.febslet.2006.10.068. PMID 17101137. S2CID 83960913.
  83. ^ a b Wolff S, Xiao Z, Wittau M, Süssner N, Stöter M, Knippschild U (September 2005). "Interaction of casein kinase 1 delta (CK1δ) with the light chain LC2 of microtubule associated protein 1A (MAP1A)". Biochimica et Biophysica Acta (BBA) - Molecular Cell Research. 1745 (2): 196–206. doi:10.1016/j.bbamcr.2005.05.004. PMID 15961172.
  84. ^ Cheng YF, Tong M, Edge AS (September 2016). "Destabilization of Atoh1 by E3 Ubiquitin Ligase Huwe1 and Casein Kinase 1 Is Essential for Normal Sensory Hair Cell Development". The Journal of Biological Chemistry. 291 (40): 21096–21109. doi:10.1074/jbc.M116.722124. PMC 5076519. PMID 27542412.
  85. ^ Hämmerlein A, Weiske J, Huber O (March 2005). "A second protein kinase CK1-mediated step negatively regulates Wnt signalling by disrupting the lymphocyte enhancer factor-1/beta-catenin complex". Cellular and Molecular Life Sciences. 62 (5): 606–18. doi:10.1007/s00018-005-4507-7. PMC 11365894. PMID 15747065. S2CID 29703683.
  86. ^ a b Aryal RP, Kwak PB, Tamayo AG, Gebert M, Chiu PL, Walz T, Weitz CJ (September 2017). "Macromolecular Assemblies of the Mammalian Circadian Clock". Molecular Cell. 67 (5): 770–782.e6. doi:10.1016/j.molcel.2017.07.017. PMC 5679067. PMID 28886335.
  87. ^ Virshup DM, Eide EJ, Forger DB, Gallego M, Harnish EV (2007). "Reversible protein phosphorylation regulates circadian rhythms". Cold Spring Harbor Symposia on Quantitative Biology. 72: 413–20. doi:10.1101/sqb.2007.72.048. PMID 18419299.
  88. ^ De Lazzari F, Bisaglia M, Zordan MA, Sandrelli F (December 2018). "Circadian Rhythm Abnormalities in Parkinson's Disease from Humans to Flies and Back". International Journal of Molecular Sciences. 19 (12): 3911. doi:10.3390/ijms19123911. PMC 6321023. PMID 30563246.
  89. ^ Ferrell JM, Chiang JY (March 2015). "Circadian rhythms in liver metabolism and disease". Acta Pharmaceutica Sinica B. 5 (2): 113–22. doi:10.1016/j.apsb.2015.01.003. PMC 4629216. PMID 26579436.
  90. ^ Leng Y, Musiek ES, Hu K, Cappuccio FP, Yaffe K (March 2019). "Association between circadian rhythms and neurodegenerative diseases". The Lancet. Neurology. 18 (3): 307–318. doi:10.1016/S1474-4422(18)30461-7. PMC 6426656. PMID 30784558.
  91. ^ Stenvers DJ, Scheer FA, Schrauwen P, la Fleur SE, Kalsbeek A (February 2019). "Circadian clocks and insulin resistance". Nature Reviews. Endocrinology. 15 (2): 75–89. doi:10.1038/s41574-018-0122-1. hdl:20.500.11755/fdb8d77a-70e3-4ab7-a041-20b2303b418b. PMID 30531917.
  92. ^ Camacho F, Cilio M, Guo Y, Virshup DM, Patel K, Khorkova O, Styren S, Morse B, Yao Z, Keesler GA (February 2001). "Human casein kinase Idelta phosphorylation of human circadian clock proteins period 1 and 2". FEBS Letters. 489 (2–3): 159–65. Bibcode:2001FEBSL.489..159C. doi:10.1016/S0014-5793(00)02434-0. PMID 11165242. S2CID 27273892.
  93. ^ Narasimamurthy R, Hunt SR, Lu Y, Fustin JM, Okamura H, Partch CL, Forger DB, Kim JK, Virshup DM (June 2018). "CK1δ/ε protein kinase primes the PER2 circadian phosphoswitch". Proceedings of the National Academy of Sciences of the United States of America. 115 (23): 5986–5991. Bibcode:2018PNAS..115.5986N. doi:10.1073/pnas.1721076115. PMC 6003379. PMID 29784789.
  94. ^ a b Xu Y, Padiath QS, Shapiro RE, Jones CR, Wu SC, Saigoh N, Saigoh K, Ptácek LJ, Fu YH (March 2005). "Functional consequences of a CKIdelta mutation causing familial advanced sleep phase syndrome". Nature. 434 (7033): 640–4. Bibcode:2005Natur.434..640X. doi:10.1038/nature03453. PMID 15800623. S2CID 4416575.
  95. ^ Nakajima M, Koinuma S, Shigeyoshi Y (August 2015). "Reduction of translation rate stabilizes circadian rhythm and reduces the magnitude of phase shift". Biochemical and Biophysical Research Communications. 464 (1): 354–9. Bibcode:2015BBRC..464..354N. doi:10.1016/j.bbrc.2015.06.158. PMID 26141234.
  96. ^ Isojima Y, Nakajima M, Ukai H, Fujishima H, Yamada RG, Masumoto KH, Kiuchi R, Ishida M, Ukai-Tadenuma M, Minami Y, Kito R, Nakao K, Kishimoto W, Yoo SH, Shimomura K, Takao T, Takano A, Kojima T, Nagai K, Sakaki Y, Takahashi JS, Ueda HR (September 2009). "CKIepsilon/delta-dependent phosphorylation is a temperature-insensitive, period-determining process in the mammalian circadian clock". Proceedings of the National Academy of Sciences of the United States of America. 106 (37): 15744–9. Bibcode:2009PNAS..10615744I. doi:10.1073/pnas.0908733106. PMC 2736905. PMID 19805222.
  97. ^ Lee H, Chen R, Lee Y, Yoo S, Lee C (December 2009). "Essential roles of CKIdelta and CKIepsilon in the mammalian circadian clock". Proceedings of the National Academy of Sciences of the United States of America. 106 (50): 21359–64. doi:10.1073/pnas.0906651106. PMC 2795500. PMID 19948962.
  98. ^ Lee JW, Hirota T, Peters EC, Garcia M, Gonzalez R, Cho CY, Wu X, Schultz PG, Kay SA (November 2011). "A small molecule modulates circadian rhythms through phosphorylation of the period protein". Angewandte Chemie. 50 (45): 10608–11. Bibcode:2011ACIE...5010608L. doi:10.1002/anie.201103915. PMC 3755734. PMID 21954091.
  99. ^ Mieda M, Okamoto H, Sakurai T (September 2016). "Manipulating the Cellular Circadian Period of Arginine Vasopressin Neurons Alters the Behavioral Circadian Period". Current Biology. 26 (18): 2535–2542. Bibcode:2016CBio...26.2535M. doi:10.1016/j.cub.2016.07.022. hdl:2297/46537. PMID 27568590.
  100. ^ Higashimoto Y, Saito S, Tong XH, Hong A, Sakaguchi K, Appella E, Anderson CW (July 2000). "Human p53 is phosphorylated on serines 6 and 9 in response to DNA damage-inducing agents". The Journal of Biological Chemistry. 275 (30): 23199–203. doi:10.1074/jbc.M002674200. PMID 10930428.
  101. ^ MacLaine NJ, Oster B, Bundgaard B, Fraser JA, Buckner C, Lazo PA, Meek DW, Höllsberg P, Hupp TR (October 2008). "A central role for CK1 in catalyzing phosphorylation of the p53 transactivation domain at serine 20 after HHV-6B viral infection". The Journal of Biological Chemistry. 283 (42): 28563–73. doi:10.1074/jbc.M804433200. PMC 2661408. PMID 18669630.
  102. ^ Brown KC (March 1991). "Improving work performance". AAOHN Journal. 39 (3): 136–7. doi:10.1177/216507999103900306. PMID 2001275.
  103. ^ Alsheich-Bartok O, Haupt S, Alkalay-Snir I, Saito S, Appella E, Haupt Y (June 2008). "PML enhances the regulation of p53 by CK1 in response to DNA damage". Oncogene. 27 (26): 3653–61. doi:10.1038/sj.onc.1211036. PMID 18246126.
  104. ^ Dumaz N, Milne DM, Meek DW (December 1999). "Protein kinase CK1 is a p53-threonine 18 kinase which requires prior phosphorylation of serine 15". FEBS Letters. 463 (3): 312–6. Bibcode:1999FEBSL.463..312D. doi:10.1016/S0014-5793(99)01647-6. PMID 10606744. S2CID 27610985.
  105. ^ Blattner C, Hay T, Meek DW, Lane DP (September 2002). "Hypophosphorylation of Mdm2 augments p53 stability". Molecular and Cellular Biology. 22 (17): 6170–82. doi:10.1128/MCB.22.17.6170-6182.2002. PMC 134018. PMID 12167711.
  106. ^ Winter M, Milne D, Dias S, Kulikov R, Knippschild U, Blattner C, Meek D (December 2004). "Protein kinase CK1delta phosphorylates key sites in the acidic domain of murine double-minute clone 2 protein (MDM2) that regulate p53 turnover". Biochemistry. 43 (51): 16356–64. doi:10.1021/bi0489255. PMID 15610030.
  107. ^ Inuzuka H, Fukushima H, Shaik S, Wei W (November 2010). "Novel insights into the molecular mechanisms governing Mdm2 ubiquitination and destruction". Oncotarget. 1 (7): 685–90. doi:10.18632/oncotarget.202. PMC 3248122. PMID 21317463.
  108. ^ Inuzuka H, Tseng A, Gao D, Zhai B, Zhang Q, Shaik S, Wan L, Ang XL, Mock C, Yin H, Stommel JM, Gygi S, Lahav G, Asara J, Xiao ZX, Kaelin WG, Harper JW, Wei W (August 2010). "Phosphorylation by casein kinase I promotes the turnover of the Mdm2 oncoprotein via the SCF(beta-TRCP) ubiquitin ligase". Cancer Cell. 18 (2): 147–59. doi:10.1016/j.ccr.2010.06.015. PMC 2923652. PMID 20708156.
  109. ^ Wang Z, Inuzuka H, Zhong J, Fukushima H, Wan L, Liu P, Wei W (September 2012). "DNA damage-induced activation of ATM promotes β-TRCP-mediated Mdm2 ubiquitination and destruction". Oncotarget. 3 (9): 1026–35. doi:10.18632/oncotarget.640. PMC 3660052. PMID 22976441.
  110. ^ Kalousi A, Mylonis I, Politou AS, Chachami G, Paraskeva E, Simos G (September 2010). "Casein kinase 1 regulates human hypoxia-inducible factor HIF-1". Journal of Cell Science. 123 (Pt 17): 2976–86. doi:10.1242/jcs.068122. PMID 20699359.
  111. ^ Kourti M, Ikonomou G, Giakoumakis NN, Rapsomaniki MA, Landegren U, Siniossoglou S, Lygerou Z, Simos G, Mylonis I (June 2015). "CK1δ restrains lipin-1 induction, lipid droplet formation and cell proliferation under hypoxia by reducing HIF-1α/ARNT complex formation". Cellular Signalling. 27 (6): 1129–40. doi:10.1016/j.cellsig.2015.02.017. PMC 4390155. PMID 25744540.
  112. ^ Grozav AG, Chikamori K, Kozuki T, Grabowski DR, Bukowski RM, Willard B, Kinter M, Andersen AH, Ganapathi R, Ganapathi MK (February 2009). "Casein kinase I delta/epsilon phosphorylates topoisomerase IIalpha at serine-1106 and modulates DNA cleavage activity". Nucleic Acids Research. 37 (2): 382–92. doi:10.1093/nar/gkn934. PMC 2632902. PMID 19043076.
  113. ^ Chen H, Ma H, Inuzuka H, Diao J, Lan F, Shi YG, Wei W, Shi Y (March 2013). "DNA damage regulates UHRF1 stability via the SCF(β-TrCP) E3 ligase". Molecular and Cellular Biology. 33 (6): 1139–48. doi:10.1128/MCB.01191-12. PMC 3592027. PMID 23297342.
  114. ^ a b Chan KY, Alonso-Nuñez M, Grallert A, Tanaka K, Connolly Y, Smith DL, Hagan IM (September 2017). "Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment". The Journal of Cell Biology. 216 (9): 2795–2812. doi:10.1083/jcb.201702172. PMC 5584178. PMID 28774892.
  115. ^ a b Greer YE, Gao B, Yang Y, Nussenzweig A, Rubin JS (2017). "Lack of Casein Kinase 1 Delta Promotes Genomic Instability - the Accumulation of DNA Damage and Down-Regulation of Checkpoint Kinase 1". PLOS ONE. 12 (1) e0170903. Bibcode:2017PLoSO..1270903G. doi:10.1371/journal.pone.0170903. PMC 5268481. PMID 28125685.
  116. ^ Johnson AE, Chen JS, Gould KL (October 2013). "CK1 is required for a mitotic checkpoint that delays cytokinesis". Current Biology. 23 (19): 1920–6. Bibcode:2013CBio...23.1920J. doi:10.1016/j.cub.2013.07.077. PMC 4078987. PMID 24055157.
  117. ^ a b Penas C, Govek EE, Fang Y, Ramachandran V, Daniel M, Wang W, Maloof ME, Rahaim RJ, Bibian M, Kawauchi D, Finkelstein D, Han JL, Long J, Li B, Robbins DJ, Malumbres M, Roussel MF, Roush WR, Hatten ME, Ayad NG (April 2015). "Casein kinase 1δ is an APC/C(Cdh1) substrate that regulates cerebellar granule cell neurogenesis". Cell Reports. 11 (2): 249–60. doi:10.1016/j.celrep.2015.03.016. PMC 4401652. PMID 25843713.
  118. ^ a b Penas C, Ramachandran V, Simanski S, Lee C, Madoux F, Rahaim RJ, Chauhan R, Barnaby O, Schurer S, Hodder P, Steen J, Roush WR, Ayad NG (July 2014). "Casein kinase 1δ-dependent Wee1 protein degradation". The Journal of Biological Chemistry. 289 (27): 18893–903. doi:10.1074/jbc.M114.547661. PMC 4081930. PMID 24817118.
  119. ^ a b Phadnis N, Cipak L, Polakova S, Hyppa RW, Cipakova I, Anrather D, Karvaiova L, Mechtler K, Smith GR, Gregan J (May 2015). "Casein Kinase 1 and Phosphorylation of Cohesin Subunit Rec11 (SA3) Promote Meiotic Recombination through Linear Element Formation". PLOS Genetics. 11 (5) e1005225. doi:10.1371/journal.pgen.1005225. PMC 4439085. PMID 25993311.
  120. ^ a b Sakuno T, Watanabe Y (January 2015). "Phosphorylation of cohesin Rec11/SA3 by casein kinase 1 promotes homologous recombination by assembling the meiotic chromosome axis". Developmental Cell. 32 (2): 220–30. doi:10.1016/j.devcel.2014.11.033. PMID 25579976.
  121. ^ Behrend L, Milne DM, Stöter M, Deppert W, Campbell LE, Meek DW, Knippschild U (November 2000). "IC261, a specific inhibitor of the protein kinases casein kinase 1-delta and -epsilon, triggers the mitotic checkpoint and induces p53-dependent postmitotic effects". Oncogene. 19 (47): 5303–13. doi:10.1038/sj.onc.1203939. PMID 11103931.
  122. ^ Cheong JK, Nguyen TH, Wang H, Tan P, Voorhoeve PM, Lee SH, Virshup DM (June 2011). "IC261 induces cell cycle arrest and apoptosis of human cancer cells via CK1δ/ɛ and Wnt/β-catenin independent inhibition of mitotic spindle formation". Oncogene. 30 (22): 2558–69. doi:10.1038/onc.2010.627. PMC 3109269. PMID 21258417.
  123. ^ Benham-Pyle BW, Sim JY, Hart KC, Pruitt BL, Nelson WJ (October 2016). "Increasing β-catenin/Wnt3A activity levels drive mechanical strain-induced cell cycle progression through mitosis". eLife. 5 e19799. doi:10.7554/eLife.19799. PMC 5104517. PMID 27782880.
  124. ^ Zhang B, Butler AM, Shi Q, Xing S, Herman PK (September 2018). "P-Body Localization of the Hrr25/Casein Kinase 1 Protein Kinase Is Required for the Completion of Meiosis". Molecular and Cellular Biology. 38 (17) e00678-17. doi:10.1128/MCB.00678-17. PMC 6094056. PMID 29915153.
  125. ^ Zhang B, Shi Q, Varia SN, Xing S, Klett BM, Cook LA, Herman PK (July 2016). "The Activity-Dependent Regulation of Protein Kinase Stability by the Localization to P-Bodies". Genetics. 203 (3): 1191–202. doi:10.1534/genetics.116.187419. PMC 4937477. PMID 27182950.
  126. ^ Argüello-Miranda O, Zagoriy I, Mengoli V, Rojas J, Jonak K, Oz T, Graf P, Zachariae W (January 2017). "Casein Kinase 1 Coordinates Cohesin Cleavage, Gametogenesis, and Exit from M Phase in Meiosis II". Developmental Cell. 40 (1): 37–52. doi:10.1016/j.devcel.2016.11.021. PMID 28017619.
  127. ^ Ishiguro T, Tanaka K, Sakuno T, Watanabe Y (May 2010). "Shugoshin-PP2A counteracts casein-kinase-1-dependent cleavage of Rec8 by separase". Nature Cell Biology. 12 (5): 500–6. doi:10.1038/ncb2052. PMID 20383139. S2CID 9720078.
  128. ^ Katis VL, Lipp JJ, Imre R, Bogdanova A, Okaz E, Habermann B, Mechtler K, Nasmyth K, Zachariae W (March 2010). "Rec8 phosphorylation by casein kinase 1 and Cdc7-Dbf4 kinase regulates cohesin cleavage by separase during meiosis". Developmental Cell. 18 (3): 397–409. doi:10.1016/j.devcel.2010.01.014. PMC 2994640. PMID 20230747.
  129. ^ Rumpf C, Cipak L, Dudas A, Benko Z, Pozgajova M, Riedel CG, Ammerer G, Mechtler K, Gregan J (July 2010). "Casein kinase 1 is required for efficient removal of Rec8 during meiosis I". Cell Cycle. 9 (13): 2657–62. doi:10.4161/cc.9.13.12146. PMC 3083834. PMID 20581463.
  130. ^ a b Stöter M, Bamberger AM, Aslan B, Kurth M, Speidel D, Löning T, Frank HG, Kaufmann P, Löhler J, Henne-Bruns D, Deppert W, Knippschild U (December 2005). "Inhibition of casein kinase I delta alters mitotic spindle formation and induces apoptosis in trophoblast cells". Oncogene. 24 (54): 7964–75. doi:10.1038/sj.onc.1208941. PMID 16027726.
  131. ^ Brouhard GJ, Rice LM (July 2018). "Microtubule dynamics: an interplay of biochemistry and mechanics". Nature Reviews Molecular Cell Biology. 19 (7): 451–463. doi:10.1038/s41580-018-0009-y. PMC 6019280. PMID 29674711.
  132. ^ Hanger DP, Byers HL, Wray S, Leung KY, Saxton MJ, Seereeram A, Reynolds CH, Ward MA, Anderton BH (August 2007). "Novel phosphorylation sites in tau from Alzheimer brain support a role for casein kinase 1 in disease pathogenesis". The Journal of Biological Chemistry. 282 (32): 23645–54. doi:10.1074/jbc.M703269200. PMID 17562708.
  133. ^ León-Espinosa G, García E, García-Escudero V, Hernández F, Defelipe J, Avila J (July 2013). "Changes in tau phosphorylation in hibernating rodents". Journal of Neuroscience Research. 91 (7): 954–62. doi:10.1002/jnr.23220. hdl:10261/95658. PMID 23606524. S2CID 20563508.
  134. ^ a b Li G, Yin H, Kuret J (April 2004). "Casein Kinase 1 Delta Phosphorylates Tau and Disrupts Its Binding to Microtubules". The Journal of Biological Chemistry. 279 (16): 15938–45. doi:10.1074/jbc.M314116200. PMID 14761950.
  135. ^ a b Amit S, Hatzubai A, Birman Y, Andersen JS, Ben-Shushan E, Mann M, Ben-Neriah Y, Alkalay I (May 2002). "Axin-mediated CKI phosphorylation of beta-catenin at Ser 45: a molecular switch for the Wnt pathway". Genes & Development. 16 (9): 1066–76. doi:10.1101/gad.230302. PMC 186245. PMID 12000790.
  136. ^ Gao ZH, Seeling JM, Hill V, Yochum A, Virshup DM (February 2002). "Casein kinase I phosphorylates and destabilizes the beta-catenin degradation complex". Proceedings of the National Academy of Sciences of the United States of America. 99 (3): 1182–7. Bibcode:2002PNAS...99.1182G. doi:10.1073/pnas.032468199. PMC 122164. PMID 11818547.
  137. ^ Ha NC, Tonozuka T, Stamos JL, Choi HJ, Weis WI (August 2004). "Mechanism of phosphorylation-dependent binding of APC to beta-catenin and its role in beta-catenin degradation". Molecular Cell. 15 (4): 511–21. doi:10.1016/j.molcel.2004.08.010. PMID 15327768.
  138. ^ Xing Y, Clements WK, Kimelman D, Xu W (November 2003). "Crystal structure of a beta-catenin/axin complex suggests a mechanism for the beta-catenin destruction complex". Genes & Development. 17 (22): 2753–64. doi:10.1101/gad.1142603. PMC 280624. PMID 14600025.
  139. ^ Jiang K, Liu Y, Fan J, Epperly G, Gao T, Jiang J, Jia J (November 2014). "Hedgehog-regulated atypical PKC promotes phosphorylation and activation of Smoothened and Cubitus interruptus in Drosophila". Proceedings of the National Academy of Sciences of the United States of America. 111 (45): E4842-50. Bibcode:2014PNAS..111E4842J. doi:10.1073/pnas.1417147111. PMC 4234617. PMID 25349414.
  140. ^ Shi Q, Li S, Li S, Jiang A, Chen Y, Jiang J (December 2014). "Hedgehog-induced phosphorylation by CK1 sustains the activity of Ci/Gli activator". Proceedings of the National Academy of Sciences of the United States of America. 111 (52): E5651-60. Bibcode:2014PNAS..111E5651S. doi:10.1073/pnas.1416652111. PMC 4284548. PMID 25512501.
  141. ^ Smelkinson MG, Zhou Q, Kalderon D (October 2007). "Regulation of Ci-SCFSlimb binding, Ci proteolysis, and hedgehog pathway activity by Ci phosphorylation". Developmental Cell. 13 (4): 481–95. doi:10.1016/j.devcel.2007.09.006. PMC 2063588. PMID 17925225.
  142. ^ Price MA, Kalderon D (March 2002). "Proteolysis of the Hedgehog signaling effector Cubitus interruptus requires phosphorylation by Glycogen Synthase Kinase 3 and Casein Kinase 1". Cell. 108 (6): 823–35. doi:10.1016/S0092-8674(02)00664-5. PMID 11955435. S2CID 7257576.
  143. ^ Zhao B, Li L, Tumaneng K, Wang CY, Guan KL (January 2010). "A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta-TRCP)". Genes & Development. 24 (1): 72–85. doi:10.1101/gad.1843810. PMC 2802193. PMID 20048001.
  144. ^ Azzolin L, Panciera T, Soligo S, Enzo E, Bicciato S, Dupont S, Bresolin S, Frasson C, Basso G, Guzzardo V, Fassina A, Cordenonsi M, Piccolo S (July 2014). "YAP/TAZ incorporation in the β-catenin destruction complex orchestrates the Wnt response". Cell. 158 (1): 157–70. doi:10.1016/j.cell.2014.06.013. hdl:11380/1030720. PMID 24976009.
  145. ^ Azzolin L, Zanconato F, Bresolin S, Forcato M, Basso G, Bicciato S, Cordenonsi M, Piccolo S (December 2012). "Role of TAZ as mediator of Wnt signaling". Cell. 151 (7): 1443–56. doi:10.1016/j.cell.2012.11.027. hdl:11380/896689. PMID 23245942.
  146. ^ a b Heallen T, Zhang M, Wang J, Bonilla-Claudio M, Klysik E, Johnson RL, Martin JF (April 2011). "Hippo pathway inhibits Wnt signaling to restrain cardiomyocyte proliferation and heart size". Science. 332 (6028): 458–61. Bibcode:2011Sci...332..458H. doi:10.1126/science.1199010. PMC 3133743. PMID 21512031.
  147. ^ a b c Imajo M, Miyatake K, Iimura A, Miyamoto A, Nishida E (March 2012). "A molecular mechanism that links Hippo signalling to the inhibition of Wnt/β-catenin signalling". The EMBO Journal. 31 (5): 1109–22. doi:10.1038/emboj.2011.487. PMC 3297994. PMID 22234184.
  148. ^ Konsavage WM, Yochum GS (February 2013). "Intersection of Hippo/YAP and Wnt/β-catenin signaling pathways". Acta Biochimica et Biophysica Sinica. 45 (2): 71–9. doi:10.1093/abbs/gms084. PMID 23027379.
  149. ^ Park HW, Kim YC, Yu B, Moroishi T, Mo JS, Plouffe SW, Meng Z, Lin KC, Yu FX, Alexander CM, Wang CY, Guan KL (August 2015). "Alternative Wnt Signaling Activates YAP/TAZ". Cell. 162 (4): 780–94. doi:10.1016/j.cell.2015.07.013. PMC 4538707. PMID 26276632.
  150. ^ Rosenbluh J, Nijhawan D, Cox AG, Li X, Neal JT, Schafer EJ, Zack TI, Wang X, Tsherniak A, Schinzel AC, Shao DD, Schumacher SE, Weir BA, Vazquez F, Cowley GS, Root DE, Mesirov JP, Beroukhim R, Kuo CJ, Goessling W, Hahn WC (December 2012). "β-Catenin-driven cancers require a YAP1 transcriptional complex for survival and tumorigenesis". Cell. 151 (7): 1457–73. doi:10.1016/j.cell.2012.11.026. PMC 3530160. PMID 23245941.
  151. ^ a b Varelas X, Miller BW, Sopko R, Song S, Gregorieff A, Fellouse FA, Sakuma R, Pawson T, Hunziker W, McNeill H, Wrana JL, Attisano L (April 2010). "The Hippo pathway regulates Wnt/beta-catenin signaling". Developmental Cell. 18 (4): 579–91. doi:10.1016/j.devcel.2010.03.007. PMID 20412773.
  152. ^ Wang X, Huai G, Wang H, Liu Y, Qi P, Shi W, Peng J, Yang H, Deng S, Wang Y (March 2018). "Mutual regulation of the Hippo/Wnt/LPA/TGF‑β signaling pathways and their roles in glaucoma (Review)". International Journal of Molecular Medicine. 41 (3): 1201–1212. doi:10.3892/ijmm.2017.3352. PMC 5819904. PMID 29286147.
  153. ^ Ferraiuolo M, Verduci L, Blandino G, Strano S (May 2017). "Mutant p53 Protein and the Hippo Transducers YAP and TAZ: A Critical Oncogenic Node in Human Cancers". International Journal of Molecular Sciences. 18 (5): 961. doi:10.3390/ijms18050961. PMC 5454874. PMID 28467351.
  154. ^ Furth N, Aylon Y, Oren M (January 2018). "p53 shades of Hippo". Cell Death and Differentiation. 25 (1): 81–92. doi:10.1038/cdd.2017.163. PMC 5729527. PMID 28984872.
  155. ^ Brockschmidt C, Hirner H, Huber N, Eismann T, Hillenbrand A, Giamas G, Radunsky B, Ammerpohl O, Bohm B, Henne-Bruns D, Kalthoff H, Leithäuser F, Trauzold A, Knippschild U (June 2008). "Anti-apoptotic and growth-stimulatory functions of CK1 delta and epsilon in ductal adenocarcinoma of the pancreas are inhibited by IC261 in vitro and in vivo". Gut. 57 (6): 799–806. doi:10.1136/gut.2007.123695. PMID 18203806. S2CID 5505400.
  156. ^ Maritzen T, Löhler J, Deppert W, Knippschild U (July 2003). "Casein kinase I delta (CKIdelta) is involved in lymphocyte physiology". European Journal of Cell Biology. 82 (7): 369–78. doi:10.1078/0171-9335-00323. PMID 12924632.
  157. ^ a b Schittek B, Sinnberg T (October 2014). "Biological functions of casein kinase 1 isoforms and putative roles in tumorigenesis". Molecular Cancer. 13: 231. doi:10.1186/1476-4598-13-231. PMC 4201705. PMID 25306547.
  158. ^ Winkler BS, Oltmer F, Richter J, Bischof J, Xu P, Burster T, Leithäuser F, Knippschild U (2015). "CK1δ in lymphoma: gene expression and mutation analyses and validation of CK1δ kinase activity for therapeutic application". Frontiers in Cell and Developmental Biology. 3: 9. doi:10.3389/fcell.2015.00009. PMC 4335261. PMID 25750912.
  159. ^ Richter J, Ullah K, Xu P, Alscher V, Blatz A, Peifer C, Halekotte J, Leban J, Vitt D, Holzmann K, Bakulev V, Pinna LA, Henne-Bruns D, Hillenbrand A, Kornmann M, Leithäuser F, Bischof J, Knippschild U (June 2015). "Effects of altered expression and activity levels of CK1δ and ɛ on tumor growth and survival of colorectal cancer patients". International Journal of Cancer. 136 (12): 2799–810. doi:10.1002/ijc.29346. hdl:10995/73239. PMID 25404202. S2CID 5319190.
  160. ^ Tsai IC, Woolf M, Neklason DW, Branford WW, Yost HJ, Burt RW, Virshup DM (March 2007). "Disease-associated casein kinase I delta mutation may promote adenomatous polyps formation via a Wnt/beta-catenin independent mechanism". International Journal of Cancer. 120 (5): 1005–12. doi:10.1002/ijc.22368. PMID 17131344. S2CID 84211197.
  161. ^ Ebisawa T (February 2007). "Circadian rhythms in the CNS and peripheral clock disorders: human sleep disorders and clock genes". Journal of Pharmacological Sciences. 103 (2): 150–4. doi:10.1254/jphs.FMJ06003X5. PMID 17299246.
  162. ^ Yasojima K, Kuret J, DeMaggio AJ, McGeer E, McGeer PL (May 2000). "Casein kinase 1 delta mRNA is upregulated in Alzheimer disease brain". Brain Research. 865 (1): 116–20. doi:10.1016/S0006-8993(00)02200-9. PMID 10814741. S2CID 10290619.
  163. ^ Schwab C, DeMaggio AJ, Ghoshal N, Binder LI, Kuret J, McGeer PL (1999). "Casein kinase 1 delta is associated with pathological accumulation of tau in several neurodegenerative diseases". Neurobiology of Aging. 21 (4): 503–10. doi:10.1016/S0197-4580(00)00110-X. PMID 10924763. S2CID 21514992.
  164. ^ Thal DR, Del Tredici K, Ludolph AC, Hoozemans JJ, Rozemuller AJ, Braak H, Knippschild U (November 2011). "Stages of granulovacuolar degeneration: their relation to Alzheimer's disease and chronic stress response". Acta Neuropathologica. 122 (5): 577–89. doi:10.1007/s00401-011-0871-6. hdl:1871/34648. PMID 21935637. S2CID 11907559.
  165. ^ Kametani F, Nonaka T, Suzuki T, Arai T, Dohmae N, Akiyama H, Hasegawa M (May 2009). "Identification of casein kinase-1 phosphorylation sites on TDP-43". Biochemical and Biophysical Research Communications. 382 (2): 405–9. Bibcode:2009BBRC..382..405K. doi:10.1016/j.bbrc.2009.03.038. PMID 19285963.
  166. ^ Alquezar C, Salado IG, de la Encarnación A, Pérez DI, Moreno F, Gil C, de Munain AL, Martínez A, Martín-Requero Á (April 2016). "Targeting TDP-43 phosphorylation by Casein Kinase-1δ inhibitors: a novel strategy for the treatment of frontotemporal dementia". Molecular Neurodegeneration. 11 (1) 36. doi:10.1186/s13024-016-0102-7. PMC 4852436. PMID 27138926.
  167. ^ Kosten J, Binolfi A, Stuiver M, Verzini S, Theillet FX, Bekei B, van Rossum M, Selenko P (December 2014). "Efficient modification of alpha-synuclein serine 129 by protein kinase CK1 requires phosphorylation of tyrosine 125 as a priming event". ACS Chemical Neuroscience. 5 (12): 1203–8. doi:10.1021/cn5002254. PMID 25320964.
  168. ^ Shanware NP, Hutchinson JA, Kim SH, Zhan L, Bowler MJ, Tibbetts RS (April 2011). "Casein kinase 1-dependent phosphorylation of familial advanced sleep phase syndrome-associated residues controls PERIOD 2 stability". The Journal of Biological Chemistry. 286 (14): 12766–74. doi:10.1074/jbc.M111.224014. PMC 3069476. PMID 21324900.
  169. ^ Cunningham PS, Ahern SA, Smith LC, da Silva Santos CS, Wager TT, Bechtold DA (July 2016). "Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity". Scientific Reports. 6 29983. Bibcode:2016NatSR...629983C. doi:10.1038/srep29983. PMC 4954991. PMID 27439882.
  170. ^ Li S, Chen XW, Yu L, Saltiel AR, Lin JD (December 2011). "Circadian metabolic regulation through crosstalk between casein kinase 1δ and transcriptional coactivator PGC-1α". Molecular Endocrinology. 25 (12): 2084–93. doi:10.1210/me.2011-1227. PMC 3231836. PMID 22052997.
  171. ^ Xu P, Fischer-Posovszky P, Bischof J, Radermacher P, Wabitsch M, Henne-Bruns D, Wolf AM, Hillenbrand A, Knippschild U (May 2015). "Gene expression levels of Casein kinase 1 (CK1) isoforms are correlated to adiponectin levels in adipose tissue of morbid obese patients and site-specific phosphorylation mediated by CK1 influences multimerization of adiponectin". Molecular and Cellular Endocrinology. 406: 87–101. doi:10.1016/j.mce.2015.02.010. PMID 25724478. S2CID 23963657.
  172. ^ Dorin-Semblat D, Demarta-Gatsi C, Hamelin R, Armand F, Carvalho TG, Moniatte M, Doerig C (2015). "Malaria Parasite-Infected Erythrocytes Secrete PfCK1, the Plasmodium Homologue of the Pleiotropic Protein Kinase Casein Kinase 1". PLOS ONE. 10 (12) e0139591. Bibcode:2015PLoSO..1039591D. doi:10.1371/journal.pone.0139591. PMC 4668060. PMID 26629826.
  173. ^ Jiang S, Zhang M, Sun J, Yang X (May 2018). "Casein kinase 1α: biological mechanisms and theranostic potential". Cell Communication and Signaling. 16 (1) 23. doi:10.1186/s12964-018-0236-z. PMC 5968562. PMID 29793495.
  174. ^ Sacerdoti-Sierra N, Jaffe CL (December 1997). "Release of ecto-protein kinases by the protozoan parasite Leishmania major". The Journal of Biological Chemistry. 272 (49): 30760–5. doi:10.1074/jbc.272.49.30760. PMID 9388215.
  175. ^ Silverman JM, Clos J, de'Oliveira CC, Shirvani O, Fang Y, Wang C, Foster LJ, Reiner NE (March 2010). "An exosome-based secretion pathway is responsible for protein export from Leishmania and communication with macrophages". Journal of Cell Science. 123 (Pt 6): 842–52. doi:10.1242/jcs.056465. PMID 20159964.
  176. ^ a b Silverman JM, Clos J, Horakova E, Wang AY, Wiesgigl M, Kelly I, Lynn MA, McMaster WR, Foster LJ, Levings MK, Reiner NE (November 2010). "Leishmania exosomes modulate innate and adaptive immune responses through effects on monocytes and dendritic cells". Journal of Immunology. 185 (9): 5011–22. doi:10.4049/jimmunol.1000541. PMID 20881185.
  177. ^ Liu J, Carvalho LP, Bhattacharya S, Carbone CJ, Kumar KG, Leu NA, Yau PM, Donald RG, Weiss MJ, Baker DP, McLaughlin KJ, Scott P, Fuchs SY (December 2009). "Mammalian casein kinase 1alpha and its leishmanial ortholog regulate stability of IFNAR1 and type I interferon signaling". Molecular and Cellular Biology. 29 (24): 6401–12. doi:10.1128/MCB.00478-09. PMC 2786868. PMID 19805514.
  178. ^ a b Rachidi N, Taly JF, Durieu E, Leclercq O, Aulner N, Prina E, Pescher P, Notredame C, Meijer L, Späth GF (2014). "Pharmacological assessment defines Leishmania donovani casein kinase 1 as a drug target and reveals important functions in parasite viability and intracellular infection". Antimicrobial Agents and Chemotherapy. 58 (3): 1501–15. doi:10.1128/AAC.02022-13. PMC 3957854. PMID 24366737.
  179. ^ Barik S, Taylor RE, Chakrabarti D (October 1997). "Identification, cloning, and mutational analysis of the casein kinase 1 cDNA of the malaria parasite, Plasmodium falciparum. Stage-specific expression of the gene". The Journal of Biological Chemistry. 272 (42): 26132–8. doi:10.1074/jbc.272.42.26132. PMID 9334178.
  180. ^ Solyakov L, Halbert J, Alam MM, Semblat JP, Dorin-Semblat D, Reininger L, Bottrill AR, Mistry S, Abdi A, Fennell C, Holland Z, Demarta C, Bouza Y, Sicard A, Nivez MP, Eschenlauer S, Lama T, Thomas DC, Sharma P, Agarwal S, Kern S, Pradel G, Graciotti M, Tobin AB, Doerig C (November 2011). "Global kinomic and phospho-proteomic analyses of the human malaria parasite Plasmodium falciparum". Nature Communications. 2 565. Bibcode:2011NatCo...2..565S. doi:10.1038/ncomms1558. PMID 22127061.
  181. ^ Martel D, Beneke T, Gluenz E, Späth GF, Rachidi N (2017). "Leishmania donovani Using the CRISPR Cas9 Toolkit". BioMed Research International. 2017 4635605. doi:10.1155/2017/4635605. PMC 5733176. PMID 29333442.
  182. ^ Hombach-Barrigah A, Bartsch K, Smirlis D, Rosenqvist H, MacDonald A, Dingli F, Loew D, Späth GF, Rachidi N, Wiese M, Clos J (March 2019). "Leishmania donovani 90 kD Heat Shock Protein - Impact of Phosphosites on Parasite Fitness, Infectivity and Casein Kinase Affinity". Scientific Reports. 9 (1) 5074. Bibcode:2019NatSR...9.5074H. doi:10.1038/s41598-019-41640-0. PMC 6434042. PMID 30911045.
  183. ^ Allocco JJ, Donald R, Zhong T, Lee A, Tang YS, Hendrickson RC, Liberator P, Nare B (October 2006). "Inhibitors of casein kinase 1 block the growth of Leishmania major promastigotes in vitro". International Journal for Parasitology. 36 (12): 1249–59. doi:10.1016/j.ijpara.2006.06.013. PMID 16890941.
  184. ^ Durieu E, Prina E, Leclercq O, Oumata N, Gaboriaud-Kolar N, Vougogiannopoulou K, Aulner N, Defontaine A, No JH, Ruchaud S, Skaltsounis AL, Galons H, Späth GF, Meijer L, Rachidi N (May 2016). "From Drug Screening to Target Deconvolution: a Target-Based Drug Discovery Pipeline Using Leishmania Casein Kinase 1 Isoform 2 To Identify Compounds with Antileishmanial Activity". Antimicrobial Agents and Chemotherapy. 60 (5): 2822–33. doi:10.1128/AAC.00021-16. PMC 4862455. PMID 26902771.
  185. ^ Marhadour S, Marchand P, Pagniez F, Bazin MA, Picot C, Lozach O, Ruchaud S, Antoine M, Meijer L, Rachidi N, Le Pape P (December 2012). "Synthesis and biological evaluation of 2,3-diarylimidazo[1,2-a]pyridines as antileishmanial agents". European Journal of Medicinal Chemistry. 58: 543–56. doi:10.1016/j.ejmech.2012.10.048. PMID 23164660.
  186. ^ Badura L, Swanson T, Adamowicz W, Adams J, Cianfrogna J, Fisher K, Holland J, Kleiman R, Nelson F, Reynolds L, St Germain K, Schaeffer E, Tate B, Sprouse J (August 2007). "An inhibitor of casein kinase I epsilon induces phase delays in circadian rhythms under free-running and entrained conditions". The Journal of Pharmacology and Experimental Therapeutics. 322 (2): 730–8. doi:10.1124/jpet.107.122846. PMID 17502429. S2CID 85875627.
  187. ^ Kennaway DJ, Varcoe TJ, Voultsios A, Salkeld MD, Rattanatray L, Boden MJ (January 2015). "Acute inhibition of casein kinase 1δ/ε rapidly delays peripheral clock gene rhythms". Molecular and Cellular Biochemistry. 398 (1–2): 195–206. doi:10.1007/s11010-014-2219-8. hdl:2440/90207. PMID 25245819. S2CID 8227480.
  188. ^ Meng QJ, Maywood ES, Bechtold DA, Lu WQ, Li J, Gibbs JE, Dupré SM, Chesham JE, Rajamohan F, Knafels J, Sneed B, Zawadzke LE, Ohren JF, Walton KM, Wager TT, Hastings MH, Loudon AS (August 2010). "Entrainment of disrupted circadian behavior through inhibition of casein kinase 1 (CK1) enzymes". Proceedings of the National Academy of Sciences of the United States of America. 107 (34): 15240–5. Bibcode:2010PNAS..10715240M. doi:10.1073/pnas.1005101107. PMC 2930590. PMID 20696890.
  189. ^ Smadja Storz S, Tovin A, Mracek P, Alon S, Foulkes NS, Gothilf Y (2013). "Casein kinase 1δ activity: a key element in the zebrafish circadian timing system". PLOS ONE. 8 (1) e54189. Bibcode:2013PLoSO...854189S. doi:10.1371/journal.pone.0054189. PMC 3549995. PMID 23349822.
  190. ^ Sprouse J, Reynolds L, Swanson TA, Engwall M (July 2009). "Inhibition of casein kinase I epsilon/delta produces phase shifts in the circadian rhythms of Cynomolgus monkeys". Psychopharmacology. 204 (4): 735–42. doi:10.1007/s00213-009-1503-x. PMID 19277609. S2CID 9593183.
  191. ^ Walton KM, Fisher K, Rubitski D, Marconi M, Meng QJ, Sládek M, Adams J, Bass M, Chandrasekaran R, Butler T, Griffor M, Rajamohan F, Serpa M, Chen Y, Claffey M, Hastings M, Loudon A, Maywood E, Ohren J, Doran A, Wager TT (August 2009). "Selective inhibition of casein kinase 1 epsilon minimally alters circadian clock period". The Journal of Pharmacology and Experimental Therapeutics. 330 (2): 430–9. doi:10.1124/jpet.109.151415. PMID 19458106. S2CID 26565986.
  192. ^ Li D, Herrera S, Bubula N, Nikitina E, Palmer AA, Hanck DA, Loweth JA, Vezina P (July 2011). "Casein kinase 1 enables nucleus accumbens amphetamine-induced locomotion by regulating AMPA receptor phosphorylation". Journal of Neurochemistry. 118 (2): 237–47. doi:10.1111/j.1471-4159.2011.07308.x. PMC 3129449. PMID 21564097.
  193. ^ Bryant CD, Parker CC, Zhou L, Olker C, Chandrasekaran RY, Wager TT, Bolivar VJ, Loudon AS, Vitaterna MH, Turek FW, Palmer AA (March 2012). "Csnk1e is a genetic regulator of sensitivity to psychostimulants and opioids". Neuropsychopharmacology. 37 (4): 1026–35. doi:10.1038/npp.2011.287. PMC 3280656. PMID 22089318.
  194. ^ Keenan CR, Langenbach SY, Jativa F, Harris T, Li M, Chen Q, Xia Y, Gao B, Schuliga MJ, Jaffar J, Prodanovic D, Tu Y, Berhan A, Lee PV, Westall GP, Stewart AG (2018). "Casein Kinase 1δ/ε Inhibitor, PF670462 Attenuates the Fibrogenic Effects of Transforming Growth Factor-β in Pulmonary Fibrosis". Frontiers in Pharmacology. 9 738. doi:10.3389/fphar.2018.00738. PMC 6048361. PMID 30042678.
  195. ^ Hiramoto K, Yamate Y, Kasahara E, Sato EF (2018). "An Inhibitor of Casein Kinase 1ε/δ (PF670462) Prevents the Deterioration of Dextran Sodium Sulfate-induced Ulcerative Colitis Caused by UVB Eye Irradiation". International Journal of Biological Sciences. 14 (9): 992–999. doi:10.7150/ijbs.24558. PMC 6036737. PMID 29989105.
  196. ^ Salado IG, Redondo M, Bello ML, Perez C, Liachko NF, Kraemer BC, Miguel L, Lecourtois M, Gil C, Martinez A, Perez DI (March 2014). "Protein kinase CK-1 inhibitors as new potential drugs for amyotrophic lateral sclerosis". Journal of Medicinal Chemistry. 57 (6): 2755–72. doi:10.1021/jm500065f. PMC 3969104. PMID 24592867.
  197. ^ Bischof J, Leban J, Zaja M, Grothey A, Radunsky B, Othersen O, Strobl S, Vitt D, Knippschild U (October 2012). "2-Benzamido-N-(1H-benzo[d]imidazol-2-yl)thiazole-4-carboxamide derivatives as potent inhibitors of CK1δ/ε". Amino Acids. 43 (4): 1577–91. doi:10.1007/s00726-012-1234-x. PMC 3448056. PMID 22331384.
  198. ^ García-Reyes B, Witt L, Jansen B, Karasu E, Gehring T, Leban J, Henne-Bruns D, Pichlo C, Brunstein E, Baumann U, Wesseler F, Rathmer B, Schade D, Peifer C, Knippschild U (May 2018). "Discovery of Inhibitor of Wnt Production 2 (IWP-2) and Related Compounds As Selective ATP-Competitive Inhibitors of Casein Kinase 1 (CK1) δ/ε". Journal of Medicinal Chemistry. 61 (9): 4087–4102. doi:10.1021/acs.jmedchem.8b00095. PMID 29630366.
  199. ^ Gao M, Wang M, Zheng QH (July 2018). "Synthesis of carbon-11-labeled CK1 inhibitors as new potential PET radiotracers for imaging of Alzheimer's disease". Bioorganic & Medicinal Chemistry Letters. 28 (13): 2234–2238. doi:10.1016/j.bmcl.2018.05.053. hdl:1805/16520. PMID 29859907. S2CID 44145521.
  200. ^ a b Dolde C, Bischof J, Grüter S, Montada A, Halekotte J, Peifer C, Kalbacher H, Baumann U, Knippschild U, Suter B (January 2018). "A CK1 FRET biosensor reveals that DDX3X is an essential activator of CK1ε". Journal of Cell Science. 131 (1) jcs207316. doi:10.1242/jcs.207316. PMC 5818060. PMID 29222110.
  201. ^ a b Harnoš J, Ryneš J, Víšková P, Foldynová-Trantírková S, Bajard-Ešner L, Trantírek L, Bryja V (October 2018). "Analysis of binding interfaces of the human scaffold protein AXIN1 by peptide microarrays". The Journal of Biological Chemistry. 293 (42): 16337–16347. doi:10.1074/jbc.RA118.005127. PMC 6200943. PMID 30166345.
  202. ^ a b Krüger M, Kalbacher H, Kastritis PL, Bischof J, Barth H, Henne-Bruns D, Vorgias C, Sarno S, Pinna LA, Knippschild U (June 2016). "New potential peptide therapeutics perturbing CK1δ/α-tubulin interaction". Cancer Letters. 375 (2): 375–383. doi:10.1016/j.canlet.2016.03.021. hdl:11577/3185796. PMID 26996302.