TEX9

TEX9
Identifiers
AliasesTEX9, testis expressed 9
External IDsMGI: 1201610; HomoloGene: 32072; GeneCards: TEX9; OMA:TEX9 - orthologs
Orthologs
SpeciesHumanMouse
Entrez

374618

21778

Ensembl

ENSG00000151575

ENSMUSG00000090626

UniProt

Q8N6V9

Q9D845

RefSeq (mRNA)

NM_001286449
NM_198524

NM_009359

RefSeq (protein)

NP_001273378
NP_940926

NP_033385

Location (UCSC)Chr 15: 56.24 – 56.45 MbChr 9: 72.45 – 72.49 Mb
PubMed search[3][4]
Wikidata
View/Edit HumanView/Edit Mouse

Testis-expressed protein 9 is a protein that in humans is encoded the TEX9 gene. TEX9 that encodes a 391-long amino acid protein containing two coiled-coil regions.[5] The gene is conserved in many species and encodes orthologous proteins in eukarya, archaea, and one species of bacteria.[6] The function of TEX9 is not yet fully understood, but it is suggested to have ATP-binding capabilities.[5]

Gene

TEX9 is located at 15q21.3 and has 18 exons.[5] However, some exons overlap; therefore, there are only 13 distinguishable exons in the human genome.[7] TEX9 is on the sense strand and spans from base 56,365,573 to 56,428,441. TEX9 is located in the gene neighborhood of CD24P2, RFX7, MNS1, and HMGB1P33.[5][8]

Transcription Regulation

The promoter for TEX9 was determined using 19 supporting transcripts to be GXP_7531542, spanning from base 56,364,254 to base 56,365,775 on the sense strand of chromosome 15.[9] A number of transcription factors with a matrix similarity greater than or equal to 0.780 that are predicted to regulate transcription of TEX9 are listed below with their respective binding site:

Transcription factor Binding Site Strand
Estrogen response elements (ER alpha) ATTGGTCAGGCTGGTCTTG +
Retinoid receptor-related testis-associated receptor CCGACCAGAACTTGAGGGT and

TTGTAATTCAAGGTCATAA

- and +
Hypermethylated in cancer 1 CTCTGCCCAGCCT and CTTCACCCGTGAT + and -
T-box TF TBX21, dimeric binding site TACTGCTTTTGGTGTCATATCTAAG +
Sine oculis homeobox homolog 4 CTTTTGGTGTCATAT +
Ecotropic viral integration site 1 encoded factor, amino-terminal zinc finger domain AAAACCACAGTATAGAT -
Estrogen-related receptor alpha GAATTGTAATTCAAGGTCATAAA and AGTGATTTGCCCAAGG/CCATATA + and +
Regulatory factor X, 4 TTAGGTCTTTGATACATT and AGCCATTGGCGCAGCGTCA + and -
Thyroid hormone receptor, beta TCGAGGATTCAAATCCAGAAACT and CTGGTATGTAGTATAGTGCCA - and -
Homeodomain protein NKX3.2 ACTGTGAAGTGGGCACTAT +
Lentivirus LTR TATA box CCATATAACTGGTAAGT +
Cdx-2 mammalian caudal related intestinal TF GTTCCGGTATATTGACCAT -
GA binding protein TF, alpha CTCTCGCGGGAAGATGCGTCG +
Olfactory neuron-specific factor ACCTTTGAGAGCGCCCTTCTACG -
Kidney-enriched kruppel-like factor GAAGATGGCGGGGCGAAGT +
Expression of TEX9 in human tissue samples

Expression

The expression of TEX9 is highest in the testis, followed by the thyroid, duodenum, and kidney, although other tissues have been shown to express TEX9.[5] TEX9 is expected to have a subcellular localization in the cytoplasm or nucleus.[10]

Characteristics of Isoform 1

Isoform 1 of TEX9 has a 5' UTR region of 27 base pairs and a 3' UTR region of 356 base pairs.[11] The transcript is 1,559 base pairs long.[12]

Additional Primary Sequence and Variants (Isoforms)

Less common isoforms of TEX9 include isoforms: 2, X1, X2, X3, X4, X5, and X6.[5]

Protein

The theoretical molecular weight of the 391 amino acid TEX9 protein is 45kDa and the theoretical pI is 6.[13] However, the experimental molecular weight has been shown to be ~55kDa.[14]

Domains, Motifs, and Secondary Structure

The most pronounced domains in TEX9 are the two coiled-coil regions, which include amino acids 32-59 and 194-351.[15] Repetitive domains within the protein include ALEE (34-37 and 302-305) and EKYK (251-254 and 307-310).[16] TEX9 has more glutamate, lysine, and glutamine residues and less glycine residues compared to a typical human protein.[16]

TEX9 has been shown to be phosphorylated at tyrosine (Y) residues 85 and 264, and have a ubiquitylation site at the lysine (K) residue at 159.[12] It is predicted that there are multiple other phosphorylation, glycation, 0-beta-GlcNAc, and SUMO protein attachment sites.[17][18][19][20]

TEX9 isoform 1 with phosphorylation (orange) and ubiquitylation (blue) sites. The structure has 99% confidence and 98% coverage.[10]

TEX9's two coiled-coil regions make up its tertiary structure and can be visualized using the predicted structure from Phyre2.[10] Shown on the structure are the two known phosphorylated sites and one ubiquitylation site.

Quaternary Structure and Protein Interactions

TEX9 has been experimentally determined to have interactions including coiled-coil containing 112 (CCDC112), chromosome 20 open reading frame 112 (C20orf112), and nucleolar protein 4 (NOL4).[21] Textmining has suggested that TEX9 also interacts with olfactory receptor, family 4, subfamily C, member 3, odorant receptor (OR4C3).[21] Other interactions include gene products of human genes NOL4-2 (at an unknown location), GOGA2 (in the cis-Golgi network membrane, spindle pole of cytoskeleton, and ER-Golgi intermediate compartment membrane), and KDM1A (in the nucleus).[13] Another proposed interaction between TEX9 involves attachment with the SUMO protein, which has a molecular weight of 11kDa.[20] The realized MW of TEX9 is 55kDa but the theoretical MW is 45kDa, which provides evidence for this interaction.[22]

Homology and Evolution

Paralogs

There are no paralogs of TEX9 in humans.[23]

Orthologs

TEX9 has homologs in over 260 other organisms, including vertebrates, invertebrates, archaea, and one species of bacteria.[5] TEX9 has been found in all clades of organisms except land plants.[23]

Genus species Common name Taxonomic group Divergence (MYA) Accession number Seq. Length (aa) Corr. ID to HP (%) Corr. Sim. To HP (%)
Homo sapiens Human Hominini 0 NP_940926.1 391 100 100
Pan paniscus Bonobo Primate 6.65 XP_008951441.1 391 99 99
Loxodonta africana African bush/savanna elephant Mammal 105 XP_010596294.1 391 83 90
Apteryx rowi Okarito (brown) kiwi Bird 312 XP_025916696.1 422 61 74
Gekko japonicus Calling gecko Reptile 312 XP_015264647.1 359 49 63
Xenopus laevis African clawed frog Amphibian 352 XP_018108534.1 434 60 76
Astyanax mexicanus Mexican tetra/blind cave fish Bony fish 432 XP_007244936.2 394 51 68
Apostichopus japonicus Japanese (spiky) sea cucumber Echinodermata 684 PIK45906.1 404 43 56
Capitella teleta Capitella Annelida 797 ELT92672.1 257 34 45
Anoplophora glabripennis Asian long-horned beetle Mollusca 797 XP_018561745.1 259 18 31
Pocillopora damicornis Cauliflower (lace) coral Cnidaria 824 XP_027039795.1 387 42 60
Clonorchis sinensis Chinese liver fluke Platyhelminthes 824 RJW72461.1 952 27 41
Echinococcus multilocularis Echinococcus Platyhelminthes 824 CDS43228.1 299 18 33
Trichoplax sp. H2 Trichoplax Placozoa 948 RDD37208.1 451 30 44
Amphimedon queenslandica Amphimedon Porifera 951.8 XP_003384031.2 339 27 41
Spizellomyces punctatus DAOM BR117 Spizellomyces Chytrid (fungi) 1105 XP_016611327.1 373 31 52
Planoprotostelium fungivorum Planoprotostelium Amoebozoa (protist) 1480 PRP73397.1 373 12 18
Klebsormidium nitens Klebsormidium Charophyte (green algae) 1496 GAQ91967.1 345 29 45
Hondaea fermentalgiana Hondaea Stramenopiles (protist) 1768 GBG25987.1 379 22 35
Thecamonas trahens ATCC 50062 Thecamonas Apusozoa (protist) 2101 XP_013753981.1 324 13 23
Chlamydia trachomatis Chlamydia Bacteria 4290 CPS19605.1 72 14 14
TEX9's mutation rate compared to fibrinogen, beta-globin, and cytochrome c.

The relative rate of change for TEX9 is fairly slow compared to fibrinogen and beta-globin, but not as slow as cytochrome c.[24]

Homologous Domains

TEX9 sequences that are most conserved between humans and other organisms are found within the two coiled-coil regions, where some amino acids are conserved in vertebrates, invertebrates, and microorganisms. The bacterial ortholog is most similar to vertebrates than invertebrates or microorganisms.

Phylogeny

Unrooted phylogenetic tree of TEX9 orthologs. Branch length represents relative evolutionary distance between organisms.

All of the orthologs of TEX9 are derived from the same common ancestor except the gene found in Chlamydia, which is thought to have transferred from humans into the bacterium.[25]

Clinical significance

Pathology

No diseases have been shown to be directly linked to TEX9, but some correlations have been found regarding estrogen receptor knockdown and increased TEX9 expression[26] as well as colorectal cancer cells with decreased TEX9 expression.[27]

Disease Association

Reduced expression of TEX9 has been shown to boost tumor growth in immunocompetent mice but not in immunocompromised mice.[28] This result suggested that TEX9 may function as a tumor antigen in some tumors. Mutations of the TEX9 protein have been found in 1-2% of tumors taken from certain cancers, including endometrial, head and neck, colorectal, and squamous lung.[29]

References

  1. ^ a b c GRCh38: Ensembl release 89: ENSG00000151575 – Ensembl, May 2017
  2. ^ a b c GRCm38: Ensembl release 89: ENSMUSG00000090626 – Ensembl, May 2017
  3. ^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. ^ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. ^ a b c d e f g "TEX9 testis expressed 9 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2019-02-08.
  6. ^ "BLAST: Basic Local Alignment Search Tool". blast.ncbi.nlm.nih.gov. Retrieved 2019-02-25.
  7. ^ "User Sequence vs Genomic". genome.ucsc.edu. Retrieved 2019-02-25.
  8. ^ "Human BLAT Search". genome.ucsc.edu. Retrieved 2019-04-21.
  9. ^ "Genomatix: Login Page". www.genomatix.de. Archived from the original on 2021-12-18. Retrieved 2019-05-05.
  10. ^ a b c "Phyre 2 alignment of TEX9_____ with c1ciiA_". www.sbg.bio.ic.ac.uk. Archived from the original on 2019-05-05. Retrieved 2019-05-05.
  11. ^ "Sequence Utilities". www.bioline.com. Retrieved 2019-05-05.
  12. ^ a b "testis-expressed protein 9 isoform 1 [Homo sapiens] - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2019-02-08.
  13. ^ a b "TEX9 - Testis-expressed protein 9 - Homo sapiens (Human) - TEX9 gene & protein". www.uniprot.org. Retrieved 2019-02-08.
  14. ^ "TEX9 - Antibodies - The Human Protein Atlas". www.proteinatlas.org. Retrieved 2019-05-05.
  15. ^ "COILS Server". embnet.vital-it.ch. Archived from the original on 2019-07-12. Retrieved 2019-04-21.
  16. ^ a b "SAPS < Sequence Statistics < EMBL-EBI". www.ebi.ac.uk. Retrieved 2019-04-21.
  17. ^ "NetPhos 3.1 Server". www.cbs.dtu.dk. Retrieved 2019-05-05.
  18. ^ "YinOYang 1.2 Server". www.cbs.dtu.dk. Retrieved 2019-05-05.
  19. ^ "NetGlycate 1.0 Server". www.cbs.dtu.dk. Retrieved 2019-05-05.
  20. ^ a b "SUMOplot™ Analysis Program | Abgent". www.abgent.com. Archived from the original on 2005-01-03. Retrieved 2019-05-05.
  21. ^ a b "TEX9 protein (human) - STRING interaction network". version-10-5.string-db.org. Retrieved 2019-02-08.
  22. ^ "SUMO Prediction". Archived from the original on 3 January 2005. Retrieved 20 April 2019.
  23. ^ a b "Protein BLAST: search protein databases using a protein query". blast.ncbi.nlm.nih.gov. Retrieved 2019-04-21.
  24. ^ "TimeTree :: The Timescale of Life". timetree.org. Retrieved 2019-05-05.
  25. ^ "Bacteria and Humans Have Been Swapping DNA for Millennia". The Scientist Magazine®. Retrieved 2019-05-05.
  26. ^ "GDS4061 / 243198_at". www.ncbi.nlm.nih.gov. Retrieved 2019-04-21.
  27. ^ "GDS4511 / 243198_at". www.ncbi.nlm.nih.gov. Retrieved 2019-04-21.
  28. ^ Shuptrine CW, Ajina R, Fertig EJ, Jablonski SA, Kim Lyerly H, Hartman ZC, Weiner LM (December 2017). "An unbiased in vivo functional genomics screening approach in mice identifies novel tumor cell-based regulators of immune rejection". Cancer Immunology, Immunotherapy. 66 (12): 1529–1544. doi:10.1007/s00262-017-2047-2. PMC 5854209. PMID 28770278.
  29. ^ "TEX9 (human)". www.phosphosite.org. Retrieved 2019-02-08.